Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

PARP9 Rabbit Polyclonal Antibody

PARP9 Rabbit Polyclonal Antibody

Contact us: [email protected]

PARP9 Polyclonal Antibody

ABP59835-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of PARP9 from Human, Mouse. This PARP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PARP9 protein at amino acid sequence of 450-530

PARP9 Polyclonal Antibody

ES11274-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PARP9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PARP9 Polyclonal Antibody

ES11274-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PARP9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PARP9 Rabbit pAb

A15526-100ul 100 ul
EUR 308

PARP9 Rabbit pAb

A15526-200ul 200 ul
EUR 459

PARP9 Rabbit pAb

A15526-20ul 20 ul
EUR 183

PARP9 Rabbit pAb

A15526-50ul 50 ul
EUR 223

PARP9 Polyclonal Conjugated Antibody

C29322 100ul
EUR 397

PARP9 antibody

70R-19121 50 ul
EUR 435
Description: Rabbit polyclonal PARP9 antibody

PARP9 antibody

70R-2874 50 ug
EUR 467
Description: Rabbit polyclonal PARP9 antibody

PARP9 Antibody

1-CSB-PA017472GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PARP9. Recognizes PARP9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal Parp9 Antibody (C-term)

APR03594G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Parp9 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal PARP9 antibody - N-terminal region

APR08944G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARP9 - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- PARP9 antibody

FNab06160 100µg
EUR 505.25
  • Immunogen: poly(ADP-ribose) polymerase family, member 9
  • Uniprot ID: Q8IXQ6
  • Gene ID: 83666
  • Research Area: Metabolism
Description: Antibody raised against PARP9

Anti-PARP9 antibody

PAab06160 100 ug
EUR 355

Anti-PARP9 antibody

STJ117721 100 µl
EUR 277

Anti-PARP9 antibody

STJ192432 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PARP9

PARP9 siRNA

20-abx927770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PARP9 siRNA

20-abx927771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PARP9 Blocking Peptide

33R-5013 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP9 antibody, catalog no. 70R-2874

PARP9 cloning plasmid

CSB-CL815575HU-10ug 10ug
EUR 798
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggacttttccatggtggccggagcagcagcttacaatgaaaaatcagagactggtgctcttggagaaaactatagttggcaaattcccattaaccacaatgacttcaaaattttaaaaaataatgagcgtcagctgtgtgaagtcctccagaataagtttggctgtatctcta
  • Show more
Description: A cloning plasmid for the PARP9 gene.

PARP9 ELISA KIT|Human

EF001569 96 Tests
EUR 689

Mouse PARP9 shRNA Plasmid

20-abx979015
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PARP9 shRNA Plasmid

20-abx963159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PARP9 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages