RGMA Rabbit Polyclonal Antibody
Contact us: [email protected]
 RGMA Polyclonal Antibody |
|
ABP60147-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RGMA protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGMA from Human, Mouse. This RGMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGMA protein |
RGMA Polyclonal Antibody |
|
ABP60147-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RGMA protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGMA from Human, Mouse. This RGMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGMA protein |
RGMA Polyclonal Antibody |
|
ES11117-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against RGMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RGMA Polyclonal Antibody |
|
ES11117-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RGMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 RGMA Rabbit pAb |
|
A4878-100ul |
Abclonal |
100 ul |
EUR 308 |
RGMA Rabbit pAb |
|
A4878-200ul |
Abclonal |
200 ul |
EUR 459 |
RGMA Rabbit pAb |
|
A4878-20ul |
Abclonal |
20 ul |
EUR 183 |
RGMA Rabbit pAb |
|
A4878-50ul |
Abclonal |
50 ul |
EUR 223 |
 RGMA Polyclonal Conjugated Antibody |
|
C30620 |
SAB |
100ul |
EUR 397 |
 ELISA Kit) Human Repulsive Guidance Molecule A (RGMA) ELISA Kit |
|
DLR-RGMA-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Repulsive Guidance Molecule A (RGMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Repulsive Guidance Molecule A (RGMA) in samples from serum, plasma or other biological fluids. |
Human Repulsive Guidance Molecule A (RGMA) ELISA Kit |
|
DLR-RGMA-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Repulsive Guidance Molecule A (RGMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Repulsive Guidance Molecule A (RGMA) in samples from serum, plasma or other biological fluids. |
Human Repulsive Guidance Molecule A (RGMA) ELISA Kit |
|
RDR-RGMA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Repulsive Guidance Molecule A (RGMA) ELISA Kit |
|
RDR-RGMA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 ELISA Kit) Human Repulsive guidance molecule A (RGMA) ELISA Kit |
|
RD-RGMA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Repulsive guidance molecule A (RGMA) ELISA Kit |
|
RD-RGMA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 RGMA antibody |
|
70R-19868 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RGMA antibody |
 RGMA Antibody |
|
1-CSB-PA836186LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RGMA Antibody |
|
1-CSB-PA019628GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 RGMA Polyclonal Antibody, HRP Conjugated |
|
A66451 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 RGMA Polyclonal Antibody, FITC Conjugated |
|
A66452 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 RGMA Polyclonal Antibody, Biotin Conjugated |
|
A66453 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 anti- RGMA antibody |
|
FNab07261 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: RGM domain family, member A
- Uniprot ID: Q96B86
- Gene ID: 56963
- Research Area: Neuroscience
|
|
Description: Antibody raised against RGMA |
 Anti-RGMA antibody |
|
STJ25343 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. |
Anti-RGMA antibody |
|
STJ192275 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RGMA |
 RGMA siRNA |
|
20-abx931370 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGMA siRNA |
|
20-abx931371 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RGMA Antibody, HRP conjugated |
|
1-CSB-PA836186LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RGMA Antibody, FITC conjugated |
|
1-CSB-PA836186LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RGMA Antibody, Biotin conjugated |
|
1-CSB-PA836186LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RGMA cloning plasmid |
|
CSB-CL836186HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1305
- Sequence: atgggtatggggagaggggcaggacgttcagccctgggattctggccgaccctcgccttccttctctgcagcttccccgcagccacctccccgtgcaagatcctcaagtgcaactctgagttctggagcgccacgtcgggcagccacgccccagcctcagacgacacccccgagt
- Show more
|
|
Description: A cloning plasmid for the RGMA gene. |
 ELISA kit) Rabbit Repulsive guidance molecule A(RGMA) ELISA kit |
|
E04R0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Repulsive guidance molecule A(RGMA) ELISA kit |
|
E04R0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Repulsive guidance molecule A(RGMA) ELISA kit |
|
E04R0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Repulsive Guidance Molecule A (RGMA) Antibody |
|
20-abx003702 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Repulsive Guidance Molecule A (RGMA) Antibody |
|
20-abx115174 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Repulsive Guidance Molecule A (RGMA) Antibody |
|
abx030826-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RGMA Rabbit Polyclonal Antibody
