Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

RGMA Rabbit Polyclonal Antibody

RGMA Rabbit Polyclonal Antibody

Contact us: [email protected]

RGMA Polyclonal Antibody

ABP60147-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of RGMA from Human, Mouse. This RGMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGMA protein

RGMA Polyclonal Antibody

ABP60147-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of RGMA from Human, Mouse. This RGMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGMA protein

RGMA Polyclonal Antibody

ES11117-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGMA Polyclonal Antibody

ES11117-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGMA Rabbit pAb

A4878-100ul 100 ul
EUR 308

RGMA Rabbit pAb

A4878-200ul 200 ul
EUR 459

RGMA Rabbit pAb

A4878-20ul 20 ul
EUR 183

RGMA Rabbit pAb

A4878-50ul 50 ul
EUR 223

RGMA Polyclonal Conjugated Antibody

C30620 100ul
EUR 397

Human Repulsive Guidance Molecule A (RGMA) ELISA Kit

DLR-RGMA-Hu-48T 48T
EUR 517
  • Should the Human Repulsive Guidance Molecule A (RGMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Repulsive Guidance Molecule A (RGMA) in samples from serum, plasma or other biological fluids.

Human Repulsive Guidance Molecule A (RGMA) ELISA Kit

DLR-RGMA-Hu-96T 96T
EUR 673
  • Should the Human Repulsive Guidance Molecule A (RGMA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Repulsive Guidance Molecule A (RGMA) in samples from serum, plasma or other biological fluids.

Human Repulsive Guidance Molecule A (RGMA) ELISA Kit

RDR-RGMA-Hu-48Tests 48 Tests
EUR 544

Human Repulsive Guidance Molecule A (RGMA) ELISA Kit

RDR-RGMA-Hu-96Tests 96 Tests
EUR 756

Human Repulsive guidance molecule A (RGMA) ELISA Kit

RD-RGMA-Hu-48Tests 48 Tests
EUR 521

Human Repulsive guidance molecule A (RGMA) ELISA Kit

RD-RGMA-Hu-96Tests 96 Tests
EUR 723

RGMA antibody

70R-19868 50 ul
EUR 435
Description: Rabbit polyclonal RGMA antibody

RGMA Antibody

1-CSB-PA836186LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RGMA Antibody

1-CSB-PA019628GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RGMA Polyclonal Antibody, HRP Conjugated

A66451 100 µg
EUR 570.55
Description: The best epigenetics products

RGMA Polyclonal Antibody, FITC Conjugated

A66452 100 µg
EUR 570.55
Description: kits suitable for this type of research

RGMA Polyclonal Antibody, Biotin Conjugated

A66453 100 µg
EUR 570.55
Description: fast delivery possible

anti- RGMA antibody

FNab07261 100µg
EUR 548.75
  • Immunogen: RGM domain family, member A
  • Uniprot ID: Q96B86
  • Gene ID: 56963
  • Research Area: Neuroscience
Description: Antibody raised against RGMA

Anti-RGMA antibody

PAab07261 100 ug
EUR 386

Anti-RGMA antibody

STJ25343 100 µl
EUR 277
Description: This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants.

Anti-RGMA antibody

STJ192275 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGMA

RGMA siRNA

20-abx931370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGMA siRNA

20-abx931371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGMA Antibody, HRP conjugated

1-CSB-PA836186LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGMA Antibody, FITC conjugated

1-CSB-PA836186LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGMA Antibody, Biotin conjugated

1-CSB-PA836186LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGMA. Recognizes RGMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGMA cloning plasmid

CSB-CL836186HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1305
  • Sequence: atgggtatggggagaggggcaggacgttcagccctgggattctggccgaccctcgccttccttctctgcagcttccccgcagccacctccccgtgcaagatcctcaagtgcaactctgagttctggagcgccacgtcgggcagccacgccccagcctcagacgacacccccgagt
  • Show more
Description: A cloning plasmid for the RGMA gene.

pCMV-SPORT6-RGMA

PVT13156 2 ug
EUR 391

Rabbit Repulsive guidance molecule A(RGMA) ELISA kit

E04R0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Repulsive guidance molecule A(RGMA) ELISA kit

E04R0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Repulsive guidance molecule A(RGMA) ELISA kit

E04R0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Repulsive guidance molecule A(RGMA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Repulsive Guidance Molecule A (RGMA) Antibody

20-abx003702
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Repulsive Guidance Molecule A (RGMA) Antibody

20-abx115174
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Repulsive Guidance Molecule A (RGMA) Antibody

abx030826-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RGMA Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages