Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

NINJ1 Rabbit Polyclonal Antibody

NINJ1 Rabbit Polyclonal Antibody

Contact us: [email protected]

NINJ1 Polyclonal Antibody

ABP59466-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody

ABP59466-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody

ABP59466-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein

NINJ1 Polyclonal Antibody

ES11146-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NINJ1 Polyclonal Antibody

ES11146-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Ninjurin 1 (NINJ1) ELISA Kit

DLR-NINJ1-Hu-48T 48T
EUR 517
  • Should the Human Ninjurin 1 (NINJ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ninjurin 1 (NINJ1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

DLR-NINJ1-Hu-96T 96T
EUR 673
  • Should the Human Ninjurin 1 (NINJ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ninjurin 1 (NINJ1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ninjurin 1 (NINJ1) ELISA Kit

RDR-NINJ1-Hu-48Tests 48 Tests
EUR 544

Human Ninjurin 1 (NINJ1) ELISA Kit

RDR-NINJ1-Hu-96Tests 96 Tests
EUR 756

Human Ninjurin 1 (NINJ1) ELISA Kit

RD-NINJ1-Hu-48Tests 48 Tests
EUR 521

Human Ninjurin 1 (NINJ1) ELISA Kit

RD-NINJ1-Hu-96Tests 96 Tests
EUR 723

NINJ1 Rabbit pAb

A16406-100ul 100 ul
EUR 308

NINJ1 Rabbit pAb

A16406-200ul 200 ul
EUR 459

NINJ1 Rabbit pAb

A16406-20ul 20 ul
EUR 183

NINJ1 Rabbit pAb

A16406-50ul 50 ul
EUR 223

NINJ1 Polyclonal Conjugated Antibody

C29832 100ul
EUR 397

NINJ1 Antibody

1-CSB-PA856441LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NINJ1 Polyclonal Antibody, HRP Conjugated

A67087 100 µg
EUR 570.55
Description: fast delivery possible

NINJ1 Polyclonal Antibody, FITC Conjugated

A67088 100 µg
EUR 570.55
Description: reagents widely cited

NINJ1 Polyclonal Antibody, Biotin Conjugated

A67089 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal NINJ1 / Ninjurin Antibody (C-Terminus)

AMM06695G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 / Ninjurin (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NINJ1 antibody - N-terminal region

AMM06697G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Anti-NINJ1 antibody

STJ118846 100 µl
EUR 277

Anti-NINJ1 antibody

STJ192304 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NINJ1

Ninj1/ Rat Ninj1 ELISA Kit

ELI-45714r 96 Tests
EUR 886

NINJ1 siRNA

20-abx903564
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NINJ1 siRNA

20-abx925907
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NINJ1 siRNA

20-abx925908
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NINJ1 Antibody, HRP conjugated

1-CSB-PA856441LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NINJ1 Antibody, FITC conjugated

1-CSB-PA856441LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NINJ1 Antibody, Biotin conjugated

1-CSB-PA856441LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ninjurin 1 (NINJ1) Antibody

20-abx177810
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ninjurin 1 (NINJ1) Antibody

20-abx173830
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ninjurin-1 (NINJ1) Antibody

20-abx302043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NINJ1 cloning plasmid

CSB-CL856441HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
  • Show more
Description: A cloning plasmid for the NINJ1 gene.

NINJ1 cloning plasmid

CSB-CL856441HU2-10ug 10ug
EUR 238
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
  • Show more
Description: A cloning plasmid for the NINJ1 gene.

Ninjurin-1 (NINJ1) Antibody (HRP)

20-abx310403
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (FITC)

20-abx310404
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ninjurin-1 (NINJ1) Antibody (Biotin)

20-abx310405
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NINJ1 ELISA KIT|Human

EF005359 96 Tests
EUR 689

Mouse NINJ1 shRNA Plasmid

20-abx971750
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NINJ1 shRNA Plasmid

20-abx984940
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NINJ1 shRNA Plasmid

20-abx953196
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NINJ1 Recombinant Protein (Human)

RP021229 100 ug Ask for price

NINJ1 Recombinant Protein (Human)

RP021232 100 ug Ask for price

NINJ1 Recombinant Protein (Mouse)

RP154112 100 ug Ask for price

NINJ1 Recombinant Protein (Rat)

RP213935 100 ug Ask for price

Human Ninjurin 1 (NINJ1) Protein

20-abx654563
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ninj1 ORF Vector (Rat) (pORF)

ORF071313 1.0 ug DNA
EUR 506

NINJ1 ORF Vector (Human) (pORF)

ORF007077 1.0 ug DNA
EUR 95

NINJ1 ORF Vector (Human) (pORF)

ORF007078 1.0 ug DNA
EUR 95

Ninj1 ORF Vector (Mouse) (pORF)

ORF051372 1.0 ug DNA
EUR 506

NINJ1 ELISA Kit (Human) (OKCD01958)

OKCD01958 96 Wells
EUR 831
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.111 ng/mL

NINJ1 ELISA Kit (Mouse) (OKCA01735)

OKCA01735 96 Wells
EUR 846
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

NINJ1 ELISA Kit (Human) (OKCA02127)

OKCA02127 96 Wells
EUR 833
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

Human Ninjurin-1(NINJ1) ELISA kit

CSB-EL015808HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ninjurin-1(NINJ1) ELISA kit

1-CSB-EL015808HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Ninjurin-1(NINJ1) ELISA kit

CSB-EL015808MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ninjurin-1(NINJ1) ELISA kit

1-CSB-EL015808MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ninjurin 1 (NINJ1) ELISA Kit

20-abx152526
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ninjurin- 1, NINJ1 ELISA KIT

ELI-23174h 96 Tests
EUR 824

Mouse Ninjurin- 1, Ninj1 ELISA KIT

ELI-44028m 96 Tests
EUR 865

Rat Ninjurin-1 (NINJ1) ELISA Kit

abx391714-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ninjurin 1 (NINJ1) CLIA Kit

20-abx495469
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Ninjurin-1 (NINJ1) ELISA Kit

abx390057-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Ninj1 sgRNA CRISPR Lentivector set (Rat)

K6930801 3 x 1.0 ug
EUR 339

Ninj1 sgRNA CRISPR Lentivector set (Mouse)

K3656801 3 x 1.0 ug
EUR 339

NINJ1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages