Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


ROBO3 Rabbit Polyclonal Antibody

ROBO3 Rabbit Polyclonal Antibody

Contact us: [email protected]

ROBO3 Polyclonal Antibody

ES11128-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ROBO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ROBO3 Rabbit pAb

A4924-100ul 100 ul
EUR 308

ROBO3 Rabbit pAb

A4924-200ul 200 ul
EUR 459

ROBO3 Rabbit pAb

A4924-20ul 20 ul
EUR 183

ROBO3 Rabbit pAb

A4924-50ul 50 ul
EUR 223

ROBO3 Rabbit pAb

A14922-100ul 100 ul
EUR 308

ROBO3 Rabbit pAb

A14922-200ul 200 ul
EUR 459

ROBO3 Rabbit pAb

A14922-20ul 20 ul
EUR 183

ROBO3 Rabbit pAb

A14922-50ul 50 ul
EUR 223

ROBO3 antibody

70R-19937 50 ul
EUR 435
Description: Rabbit polyclonal ROBO3 antibody

ROBO3 Antibody

40083-100ul 100ul
EUR 252

ROBO3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ROBO3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ROBO3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ROBO3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal ROBO3 (internal) Antibody (internal region)

APG00458G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO3 (internal) (internal region). This antibody is tested and proven to work in the following applications:

ROBO3 Conjugated Antibody

C40083 100ul
EUR 397

ROBO3-Specific Antibody

abx237374-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

anti- ROBO3 antibody

FNab07373 100µg
EUR 548.75
  • Immunogen: roundabout, axon guidance receptor, homolog 3(Drosophila)
  • Uniprot ID: Q96MS0
  • Gene ID: 64221
  • Research Area: Neuroscience, Stem Cells, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO3

Anti-ROBO3 antibody

PAab07373 100 ug
EUR 386

Anti-ROBO3 antibody

STJ111235 100 µl
EUR 277
Description: This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated.

Anti-ROBO3 antibody

STJ117121 100 µl
EUR 277
Description: This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated.

Anti-ROBO3 antibody

STJ192286 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ROBO3

Anti-Robo3 Antibody

STJ502783 100 µg
EUR 476


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20486 50 ug
EUR 363
Description: Mouse polyclonal to Robo3


YF-PA20487 50 ul
EUR 363
Description: Mouse polyclonal to Robo3


YF-PA20488 50 ug
EUR 363
Description: Mouse polyclonal to Robo3

Polyclonal Goat Anti-ROBO3 / RIG1 (internal) Antibody

APG00286G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO3 / RIG1 (internal) . This antibody is tested and proven to work in the following applications:

anti- ROBO3-Specific antibody

FNab07374 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: roundabout, axon guidance receptor, homolog 3(Drosophila)
  • Uniprot ID: Q96MS0
  • Research Area: Neuroscience, Stem Cells, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO3-Specific

Anti-ROBO3-Specific antibody

PAab07374 100 ug
EUR 386

Anti-ROBO3 (internal) antibody

STJ70834 100 µg
EUR 359

Anti-Robo3 (mouse) antibody

STJ71172 100 µg
EUR 260

Anti-Robo3 Antibody BIOTIN

STJ502784 100 µg
EUR 586

Anti-Robo3 Antibody FITC

STJ502785 100 µg
EUR 586

ROBO3 cloning plasmid

CSB-CL846671HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atgactcccccacttcaaggaccccgtgctcgattccggaagaaacccaaggctcttccctacaggagggagaacagtcctggggacttgcccccaccacccttgccaccgccagaggaagaggcgagctgggccctagagctgagggcagcaggcagcatgtcctccctggagcg
  • Show more
Description: A cloning plasmid for the ROBO3 gene.

Anti-Robo3 (2H1)

YF-MA19219 100 ug
EUR 363
Description: Mouse monoclonal to Robo3

Anti-ROBO3 / RIG1 (internal) antibody

STJ71171 100 µg
EUR 359


EF002539 96 Tests
EUR 689

Human ROBO3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVTB00490 2 ug
EUR 356

Roundabout Guidance Receptor 3 (ROBO3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

abx145585-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

abx237373-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Roundabout Guidance Receptor 3 (ROBO3) Antibody

abx430598-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ROBO3 Rabbit Polyclonal Antibody

Recent Posts


January 2022
