ROBO3 Rabbit Polyclonal Antibody
Contact us: [email protected]
 ROBO3 Polyclonal Antibody |
|
ES11128-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ROBO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ROBO3 Rabbit pAb |
|
A4924-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO3 Rabbit pAb |
|
A4924-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO3 Rabbit pAb |
|
A4924-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO3 Rabbit pAb |
|
A4924-50ul |
Abclonal |
50 ul |
EUR 223 |
ROBO3 Rabbit pAb |
|
A14922-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO3 Rabbit pAb |
|
A14922-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO3 Rabbit pAb |
|
A14922-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO3 Rabbit pAb |
|
A14922-50ul |
Abclonal |
50 ul |
EUR 223 |
 ROBO3 antibody |
|
70R-19937 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ROBO3 antibody |
 ROBO3 Antibody |
|
40083-100ul |
SAB |
100ul |
EUR 252 |
ROBO3 Antibody |
|
1-CSB-PA846671ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ROBO3 Antibody |
|
1-CSB-PA921768 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ROBO3 Antibody |
|
1-CSB-PA291923 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ROBO3 Antibody |
|
1-CSB-PA020056GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ROBO3. Recognizes ROBO3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 Antibody (internal region)) Polyclonal ROBO3 (internal) Antibody (internal region) |
|
APG00458G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO3 (internal) (internal region). This antibody is tested and proven to work in the following applications: |
 ROBO3 Conjugated Antibody |
|
C40083 |
SAB |
100ul |
EUR 397 |
 ROBO3-Specific Antibody |
|
abx237374-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 anti- ROBO3 antibody |
|
FNab07373 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: roundabout, axon guidance receptor, homolog 3(Drosophila)
- Uniprot ID: Q96MS0
- Gene ID: 64221
- Research Area: Neuroscience, Stem Cells, Cardiovascular, Developmental biology
|
|
Description: Antibody raised against ROBO3 |
 Anti-ROBO3 antibody |
|
STJ111235 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. |
Anti-ROBO3 antibody |
|
STJ117121 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. |
Anti-ROBO3 antibody |
|
STJ192286 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ROBO3 |
 ROBO3 siRNA |
|
20-abx931834 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-Robo3 |
|
YF-PA20486 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Robo3 |
anti-Robo3 |
|
YF-PA20487 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Robo3 |
anti-Robo3 |
|
YF-PA20488 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Robo3 |
 Antibody) Polyclonal Goat Anti-ROBO3 / RIG1 (internal) Antibody |
|
APG00286G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO3 / RIG1 (internal) . This antibody is tested and proven to work in the following applications: |
 anti- ROBO3-Specific antibody |
|
FNab07374 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: roundabout, axon guidance receptor, homolog 3(Drosophila)
- Uniprot ID: Q96MS0
- Research Area: Neuroscience, Stem Cells, Cardiovascular, Developmental biology
|
|
Description: Antibody raised against ROBO3-Specific |
 ROBO3 cloning plasmid |
|
CSB-CL846671HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 444
- Sequence: atgactcccccacttcaaggaccccgtgctcgattccggaagaaacccaaggctcttccctacaggagggagaacagtcctggggacttgcccccaccacccttgccaccgccagaggaagaggcgagctgggccctagagctgagggcagcaggcagcatgtcctccctggagcg
- Show more
|
|
Description: A cloning plasmid for the ROBO3 gene. |
) Anti-Robo3 (2H1) |
|
YF-MA19219 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Robo3 |
 Human ROBO3 shRNA Plasmid |
|
20-abx961964 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
20-abx212649 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
20-abx212650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
20-abx115339 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
20-abx126491 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
abx145585-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
20-abx321054 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
abx237373-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Roundabout Guidance Receptor 3 (ROBO3) Antibody |
|
abx430598-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
ROBO3 Rabbit Polyclonal Antibody
 antibody)
 antibody)
 antibody)
