Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

NR1D2 Rabbit Polyclonal Antibody

NR1D2 Rabbit Polyclonal Antibody

Contact us: [email protected]

NR1D2 Polyclonal Antibody

ABP59521-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR1D2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NR1D2 from Human, Mouse, Rat. This NR1D2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR1D2 protein

NR1D2 Polyclonal Antibody

ES11157-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NR1D2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR1D2 Polyclonal Antibody

ES11157-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NR1D2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR1D2 Antibody

1-CSB-PA623948LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1D2. Recognizes NR1D2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

NR1D2 Antibody

DF13195 200ul
EUR 304
Description: NR1D2 Antibody detects endogenous levels of NR1D2.

anti- NR1D2 antibody

FNab05833 100µg
EUR 505.25
  • Immunogen: nuclear receptor subfamily 1, group D, member 2
  • Uniprot ID: Q14995
  • Gene ID: 9975
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against NR1D2

Anti-NR1D2 antibody

PAab05833 100 ug
EUR 355

Anti-NR1D2 antibody

STJ192315 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR1D2

Nr1d2/ Rat Nr1d2 ELISA Kit

ELI-21286r 96 Tests
EUR 886

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Hu-48T 48T
EUR 517
  • Should the Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Hu-96T 96T
EUR 673
  • Should the Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Mu-48T 48T
EUR 527
  • Should the Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Mu-96T 96T
EUR 688
  • Should the Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Ra-48T 48T
EUR 549
  • Should the Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

DLR-NR1D2-Ra-96T 96T
EUR 718
  • Should the Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) in samples from tissue homogenates or other biological fluids.

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Hu-48Tests 48 Tests
EUR 544

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Hu-96Tests 96 Tests
EUR 756

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Mu-48Tests 48 Tests
EUR 557

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Mu-96Tests 96 Tests
EUR 774

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Ra-48Tests 48 Tests
EUR 583

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RDR-NR1D2-Ra-96Tests 96 Tests
EUR 811

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Hu-48Tests 48 Tests
EUR 521

Human Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Hu-96Tests 96 Tests
EUR 723

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Mu-48Tests 48 Tests
EUR 533

Mouse Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Mu-96Tests 96 Tests
EUR 740

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Ra-48Tests 48 Tests
EUR 557

Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) ELISA Kit

RD-NR1D2-Ra-96Tests 96 Tests
EUR 775

NR1D2 siRNA

20-abx903641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR1D2 siRNA

20-abx926319
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR1D2 siRNA

20-abx926320
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NR1D2

YF-PA16623 50 ul
EUR 363
Description: Mouse polyclonal to NR1D2

anti-NR1D2

YF-PA16624 100 ug
EUR 403
Description: Rabbit polyclonal to NR1D2

NR1D2 Antibody, HRP conjugated

1-CSB-PA623948LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1D2. Recognizes NR1D2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NR1D2 Antibody, FITC conjugated

1-CSB-PA623948LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1D2. Recognizes NR1D2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NR1D2 Antibody, Biotin conjugated

1-CSB-PA623948LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NR1D2. Recognizes NR1D2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NR1D2 Blocking Peptide

DF13195-BP 1mg
EUR 195

NR1D2 cloning plasmid

CSB-CL623948HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atggaggtgaatgcaggaggtgtgattgcctatatcagttcttccagctcagcctcaagccctgcctcttgtcacagtgagggttctgagaatagtttccagtcctcctcctcttctgttccatcttctccaaatagctctaattctgataccaatggtaatcccaagaatggtg
  • Show more
Description: A cloning plasmid for the NR1D2 gene.

Human NR1D2 ELISA KIT

ELI-14853h 96 Tests
EUR 824

Mouse Nr1d2 ELISA KIT

ELI-22255m 96 Tests
EUR 865

NR1D2 ELISA KIT|Human

EF001314 96 Tests
EUR 689

Rat NR1D2 shRNA Plasmid

20-abx988052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NR1D2 shRNA Plasmid

20-abx956711
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR1D2 shRNA Plasmid

20-abx983715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR1D2 Recombinant Protein (Human)

RP021586 100 ug Ask for price

NR1D2 Recombinant Protein (Mouse)

RP154844 100 ug Ask for price

NR1D2 Recombinant Protein (Rat)

RP214436 100 ug Ask for price

Nr1d2 ORF Vector (Rat) (pORF)

ORF071480 1.0 ug DNA
EUR 506

NR1D2 ORF Vector (Human) (pORF)

ORF007196 1.0 ug DNA
EUR 95

Nr1d2 ORF Vector (Mouse) (pORF)

ORF051616 1.0 ug DNA
EUR 506

NR1D2 ELISA Kit (Rat) (OKCD08568)

OKCD08568 96 Wells
EUR 1053
Description: Description of target: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.066ng/mL

NR1D2 ELISA Kit (Rat) (OKDD00669)

OKDD00669 96 Wells
EUR 1040
Description: Description of target: This gene encodes a member of the nuclear hormone receptor family, specifically the nr1 subfamily of receptors. the encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism.;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.066 ng/mL

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat)

4-PAD946Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2)

Nr1d2 sgRNA CRISPR Lentivector set (Rat)

K7181001 3 x 1.0 ug
EUR 339

Nr1d2 sgRNA CRISPR Lentivector set (Mouse)

K3893801 3 x 1.0 ug
EUR 339

NR1D2 sgRNA CRISPR Lentivector set (Human)

K1451301 3 x 1.0 ug
EUR 339

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), APC

4-PAD946Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with APC.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), Biotinylated

4-PAD946Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with Biotin.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), Cy3

4-PAD946Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with Cy3.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), FITC

4-PAD946Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with FITC.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), HRP

4-PAD946Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with HRP.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), PE

4-PAD946Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with PE.

Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2) Polyclonal Antibody (Rat), APC-Cy7

4-PAD946Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NR1D2 (Lys249~Pro578)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Receptor Subfamily 1, Group D, Member 2 (NR1D2). This antibody is labeled with APC-Cy7.

Nr1d2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7181002 1.0 ug DNA
EUR 154

Nr1d2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7181003 1.0 ug DNA
EUR 154

Nr1d2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7181004 1.0 ug DNA
EUR 154

Nr1d2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3893802 1.0 ug DNA
EUR 154

Nr1d2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3893803 1.0 ug DNA
EUR 154

Nr1d2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3893804 1.0 ug DNA
EUR 154

NR1D2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1451302 1.0 ug DNA
EUR 154

NR1D2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1451303 1.0 ug DNA
EUR 154

NR1D2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1451304 1.0 ug DNA
EUR 154

NR1D2 Protein Vector (Rat) (pPB-C-His)

PV285918 500 ng
EUR 603

NR1D2 Protein Vector (Rat) (pPB-N-His)

PV285919 500 ng
EUR 603

NR1D2 Protein Vector (Rat) (pPM-C-HA)

PV285920 500 ng
EUR 603

NR1D2 Protein Vector (Rat) (pPM-C-His)

PV285921 500 ng
EUR 603

NR1D2 Protein Vector (Mouse) (pPB-C-His)

PV206462 500 ng
EUR 603

NR1D2 Protein Vector (Mouse) (pPB-N-His)

PV206463 500 ng
EUR 603

NR1D2 Protein Vector (Mouse) (pPM-C-HA)

PV206464 500 ng
EUR 603

NR1D2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages