Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

ID3 Rabbit Polyclonal Antibody

ID3 Rabbit Polyclonal Antibody

Contact us: [email protected]

ID3 Polyclonal Antibody
ABP58864-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
ID3 Polyclonal Antibody
ABP58864-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
ID3 Polyclonal Antibody
ES11398-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ID3 Polyclonal Antibody
ES11398-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ID3 Rabbit pAb
A5375-100ul 100 ul
EUR 308
ID3 Rabbit pAb
A5375-200ul 200 ul
EUR 459
ID3 Rabbit pAb
A5375-20ul 20 ul
EUR 183
ID3 Rabbit pAb
A5375-50ul 50 ul
EUR 223
ID3 Antibody
37640-100ul 100ul
EUR 252
ID3 antibody
38647-100ul 100ul
EUR 252
ID3 antibody
10R-4417 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4418 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4419 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4420 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4421 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4422 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4423 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody
ID3 antibody
10R-4424 100 ul
EUR 726
Description: Mouse monoclonal ID3 antibody
ID3 Antibody
DF12640 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.
ID3 Antibody
DF12520 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.
ID3 Antibody
1-CSB-PA576712
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
ID3 Antibody
1-CSB-PA01959A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
ID3 Antibody
ABF9263 100 ug
EUR 438
Polyclonal ID3 Antibody (C-Terminus)
APR02577G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID3 (C-Terminus). This antibody is tested and proven to work in the following applications:
Id3/ Rat Id3 ELISA Kit
ELI-08420r 96 Tests
EUR 886
ID3 Conjugated Antibody
C37640 100ul
EUR 397
anti- ID3 antibody
FNab04115 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
  • Uniprot ID: Q02535
  • Gene ID: 3399
  • Research Area: Neuroscience, Metabolism, Developmental bi
  • Show more
Description: Antibody raised against ID3
Anti-ID3 antibody
PAab04115 100 ug
EUR 355
Anti-ID3 antibody
STJ27328 100 µl
EUR 277
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts.
Anti-ID3 antibody
STJ192556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ID3
ID3 siRNA
20-abx902601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ID3 siRNA
20-abx920133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ID3 siRNA
20-abx920134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ID3
YF-PA12524 50 ul
EUR 363
Description: Mouse polyclonal to ID3
anti-ID3
YF-PA12525 50 ug
EUR 363
Description: Mouse polyclonal to ID3
anti-ID3
YF-PA23944 50 ul
EUR 334
Description: Mouse polyclonal to ID3
ID3 Antibody, HRP conjugated
1-CSB-PA01959B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ID3 Antibody, FITC conjugated
1-CSB-PA01959C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ID3 Antibody, Biotin conjugated
1-CSB-PA01959D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ID3 Blocking Peptide
DF12640-BP 1mg
EUR 195
ID3 Blocking Peptide
DF12520-BP 1mg
EUR 195
ID3 cloning plasmid
CSB-CL010969HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 360
  • Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtccc
  • Show more
Description: A cloning plasmid for the ID3 gene.
Anti-ID3 (4G1)
YF-MA13639 100 ug
EUR 363
Description: Mouse monoclonal to ID3
Anti-ID3 (3E10)
YF-MA13640 100 ug
EUR 363
Description: Mouse monoclonal to ID3
Anti-ID3 (2H8)
YF-MA13641 100 ug
EUR 363
Description: Mouse monoclonal to ID3
Anti-ID3 (3D3)
YF-MA13642 100 ug
EUR 363
Description: Mouse monoclonal to ID3
Canine ID3 ELISA KIT
ELI-31093d 96 Tests
EUR 928
ID3 ELISA KIT|Human
EF010278 96 Tests
EUR 689
Rat ID3 shRNA Plasmid
20-abx985140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ID3 shRNA Plasmid
20-abx952309
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ID3 shRNA Plasmid
20-abx970960
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ID3 Recombinant Protein (Human)
RP015532 100 ug Ask for price
ID3 Recombinant Protein (Rat)
RP205436 100 ug Ask for price
ID3 Recombinant Protein (Mouse)
RP142880 100 ug Ask for price
Monoclonal ID3 Antibody (monoclonal) (M02), Clone: 3E11
AMM03649G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E
Monoclonal ID3 Antibody (monoclonal) (M03), Clone: 2H8
AMM03650G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2H8. This antibody is applicable in WB and IF, E
Id3 ORF Vector (Rat) (pORF)
ORF068480 1.0 ug DNA
EUR 506
ID3 ORF Vector (Human) (pORF)
ORF005178 1.0 ug DNA
EUR 95
Id3 ORF Vector (Mouse) (pORF)
ORF047628 1.0 ug DNA
EUR 95
pECMV-Id3-m-FLAG Plasmid
PVT15045 2 ug
EUR 325
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
20-abx004116
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
abx030201-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
abx030201-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
20-abx241670
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
abx234115-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody
20-abx333779
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Id3 sgRNA CRISPR Lentivector set (Rat)
K6825601 3 x 1.0 ug
EUR 339
Id3 sgRNA CRISPR Lentivector set (Mouse)
K4367101 3 x 1.0 ug
EUR 339
ID3 sgRNA CRISPR Lentivector set (Human)
K1012601 3 x 1.0 ug
EUR 339
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (HRP)
20-abx335424
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (FITC)
20-abx335425
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (Biotin)
20-abx335426
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Id3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6825602 1.0 ug DNA
EUR 154
Id3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6825603 1.0 ug DNA
EUR 154
Id3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6825604 1.0 ug DNA
EUR 154
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4367102 1.0 ug DNA
EUR 154
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4367103 1.0 ug DNA
EUR 154
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4367104 1.0 ug DNA
EUR 154
ID3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1012602 1.0 ug DNA
EUR 154
ID3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1012603 1.0 ug DNA
EUR 154
ID3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1012604 1.0 ug DNA
EUR 154
ID3 Protein Vector (Human) (pPB-C-His)
PV020709 500 ng
EUR 329
ID3 Protein Vector (Human) (pPB-N-His)
PV020710 500 ng
EUR 329
ID3 Protein Vector (Human) (pPM-C-HA)
PV020711 500 ng
EUR 329
ID3 Protein Vector (Human) (pPM-C-His)
PV020712 500 ng
EUR 329
ID3 Protein Vector (Rat) (pPB-C-His)
PV273918 500 ng
EUR 603
ID3 Protein Vector (Rat) (pPB-N-His)
PV273919 500 ng
EUR 603
ID3 Protein Vector (Rat) (pPM-C-HA)
PV273920 500 ng
EUR 603
ID3 Protein Vector (Rat) (pPM-C-His)
PV273921 500 ng
EUR 603
ID3 Protein Vector (Mouse) (pPB-C-His)
PV190510 500 ng
EUR 603
ID3 Protein Vector (Mouse) (pPB-N-His)
PV190511 500 ng
EUR 603
ID3 Protein Vector (Mouse) (pPM-C-HA)
PV190512 500 ng
EUR 603
ID3 Protein Vector (Mouse) (pPM-C-His)
PV190513 500 ng
EUR 603
Id3 3'UTR Luciferase Stable Cell Line
TU109876 1.0 ml Ask for price
Id3 3'UTR Luciferase Stable Cell Line
TU206079 1.0 ml Ask for price
Id3 3'UTR GFP Stable Cell Line
TU159876 1.0 ml Ask for price
Id3 3'UTR GFP Stable Cell Line
TU256079 1.0 ml Ask for price
ID3 3'UTR GFP Stable Cell Line
TU060403 1.0 ml
EUR 1394
ID3 3'UTR Luciferase Stable Cell Line
TU010403 1.0 ml
EUR 1394

ID3 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages