Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

GPX3 Rabbit Polyclonal Antibody

GPX3 Rabbit Polyclonal Antibody

Contact us: [email protected]

GPX3 Polyclonal Antibody

ABP58707-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPX3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPX3 from Human, Mouse, Rat. This GPX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPX3 protein

GPX3 Polyclonal Antibody

ES10932-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPX3 Polyclonal Antibody

ES10932-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPX3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPX3 Rabbit pAb

A12956-100ul 100 ul
EUR 308

GPX3 Rabbit pAb

A12956-200ul 200 ul
EUR 459

GPX3 Rabbit pAb

A12956-20ul 20 ul
EUR 183

GPX3 Rabbit pAb

A12956-50ul 50 ul
EUR 223

GPX3 Polyclonal Conjugated Antibody

C27854 100ul
EUR 397

Polyclonal GPX3 Antibody (Center)

APR07131G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPX3 (Center). This antibody is tested and proven to work in the following applications:

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

DLR-GPX3-Hu-48T 48T
EUR 517
  • Should the Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Peroxidase 3, Plasma (GPX3) in samples from serum, plasma or other biological fluids.

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

DLR-GPX3-Hu-96T 96T
EUR 673
  • Should the Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione Peroxidase 3, Plasma (GPX3) in samples from serum, plasma or other biological fluids.

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

DLR-GPX3-Ra-48T 48T
EUR 549
  • Should the Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione Peroxidase 3, Plasma (GPX3) in samples from serum, plasma or other biological fluids.

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

DLR-GPX3-Ra-96T 96T
EUR 718
  • Should the Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione Peroxidase 3, Plasma (GPX3) in samples from serum, plasma or other biological fluids.

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RDR-GPX3-Hu-48Tests 48 Tests
EUR 544

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RDR-GPX3-Hu-96Tests 96 Tests
EUR 756

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RDR-GPX3-Ra-48Tests 48 Tests
EUR 583

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RDR-GPX3-Ra-96Tests 96 Tests
EUR 811

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RD-GPX3-Hu-48Tests 48 Tests
EUR 521

Human Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RD-GPX3-Hu-96Tests 96 Tests
EUR 723

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RD-GPX3-Ra-48Tests 48 Tests
EUR 557

Rat Glutathione Peroxidase 3, Plasma (GPX3) ELISA Kit

RD-GPX3-Ra-96Tests 96 Tests
EUR 775

GPX3 antibody

70R-5305 50 ug
EUR 467
Description: Rabbit polyclonal GPX3 antibody

Polyclonal Goat Anti-GPX3 Antibody

AMM05002G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPX3 . This antibody is tested and proven to work in the following applications:

anti- GPX3 antibody

FNab03621 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IF: 1:50-1:500
  • Immunogen: glutathione peroxidase 3(plasma)
  • Uniprot ID: P22352
  • Gene ID: 2878
  • Research Area: Metabolism
Description: Antibody raised against GPX3

Anti-GPX3 antibody

PAab03621 100 ug
EUR 355

Anti-GPX3 antibody

STJ114822 100 µl
EUR 277
Description: This gene product belongs to the glutathione peroxidase family, which functions in the detoxification of hydrogen peroxide. It contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal.

Anti-GPX3 antibody

STJ13100142 150 µl
EUR 427

Anti-GPX3 antibody

STJ13100143 500 µg
EUR 427

Anti-GPX3 antibody

STJ71124 100 µg
EUR 359

Anti-GPX3 antibody

STJ192090 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPX3

Gpx3/ Rat Gpx3 ELISA Kit

ELI-07762r 96 Tests
EUR 886

GPX3 siRNA

20-abx902298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPX3 siRNA

20-abx918610
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPX3 siRNA

20-abx918611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Gpx3

LF-PA0236 100 ul
EUR 334
Description: Rabbit polyclonal to Gpx3

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human)

4-PAC992Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3)

GPX3 Blocking Peptide

33R-1870 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPX3 antibody, catalog no. 70R-5305

GPX3 cloning plasmid

CSB-CL009868HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atggcccggctgctgcaggcgtcctgcctgctttccctgctcctggccggcttcgtctcgcagagccggggacaagagaagtcgaagatggactgccatggtggcataagtggcaccatttacgagtacggagccctcaccattgatggggaggagtacatccccttcaagcagta
  • Show more
Description: A cloning plasmid for the GPX3 gene.

pCMV-SPORT6-GPX3

PVT19136 2 ug
EUR 231

Glutathione Peroxidase 3 (GPX3) Antibody

abx026155-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione Peroxidase 3 (GPX3) Antibody

abx026155-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glutathione Peroxidase 3 (GPX3) Antibody

20-abx124324
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Glutathione Peroxidase 3 (GPX3) Antibody

abx233621-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Glutathione Peroxidase 3 (GPX3) Antibody

abx431304-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), APC

4-PAC992Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with APC.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), Biotinylated

4-PAC992Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with Biotin.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), Cy3

4-PAC992Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with Cy3.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), FITC

4-PAC992Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with FITC.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), HRP

4-PAC992Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with HRP.

Glutathione Peroxidase 3, Plasma (GPX3) Polyclonal Antibody (Human), PE

4-PAC992Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPX3 (Gln21~Tyr72)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutathione Peroxidase 3, Plasma (GPX3). This antibody is labeled with PE.

GPX3 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages