Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


NRARP Rabbit Polyclonal Antibody

NRARP Rabbit Polyclonal Antibody

Contact us: [email protected]

NRARP Polyclonal Antibody

ABP59531-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NRARP protein
  • Applications tips:
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein

NRARP Polyclonal Antibody

ABP59531-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NRARP protein
  • Applications tips:
Description: A polyclonal antibody for detection of NRARP from Human, Mouse. This NRARP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRARP protein

NRARP Polyclonal Antibody

ES10964-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRARP Polyclonal Antibody

ES10964-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NRARP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRARP Rabbit pAb

A12875-100ul 100 ul
EUR 308

NRARP Rabbit pAb

A12875-200ul 200 ul
EUR 459

NRARP Rabbit pAb

A12875-20ul 20 ul
EUR 183

NRARP Rabbit pAb

A12875-50ul 50 ul
EUR 223

Polyclonal NRARP Antibody (Center)

AMM06821G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRARP (Center). This antibody is tested and proven to work in the following applications:

NRARP Polyclonal Conjugated Antibody

C27828 100ul
EUR 397

NRARP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NRARP antibody

70R-3353 50 ug
EUR 467
Description: Rabbit polyclonal NRARP antibody raised against the middle region of NRARP

NRARP Polyclonal Antibody, HRP Conjugated

A63051 100 µg
EUR 570.55
Description: kits suitable for this type of research

NRARP Polyclonal Antibody, FITC Conjugated

A63052 100 µg
EUR 570.55
Description: fast delivery possible

NRARP Polyclonal Antibody, Biotin Conjugated

A63053 100 µg
EUR 570.55
Description: reagents widely cited

Anti-NRARP antibody

STJ114741 100 µl
EUR 277

Anti-NRARP antibody

STJ73075 100 µg
EUR 260

Anti-NRARP antibody

STJ192122 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRARP


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Goat Anti-NRARP Antibody (N Terminus)

AMM05947G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NRARP (N Terminus). This antibody is tested and proven to work in the following applications:

NRARP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRARP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRARP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRARP. Recognizes NRARP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRARP Blocking Peptide

33R-7666 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRARP antibody, catalog no. 70R-3353

NRARP cloning plasmid

CSB-CL770360HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 345
  • Sequence: atgagccaggccgagctgtccacctgctccgcgccgcagacgcagcgcatcttccaggaggctgtgcgcaagggcaacacgcaggagctgcagtcgctgctgcagaacatgaccaactgcgagttcaacgtgaactcgttcgggcccgagggccagacggcgctgcaccagtcggt
  • Show more
Description: A cloning plasmid for the NRARP gene.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP)


EF005366 96 Tests
EUR 689

Mouse NRARP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NRARP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-38150h 96 Tests
EUR 824

Mouse Nrarp ELISA KIT

ELI-39747m 96 Tests
EUR 865

NRARP Recombinant Protein (Human)

RP021631 100 ug Ask for price

NRARP Recombinant Protein (Mouse)

RP154964 100 ug Ask for price

NRARP Recombinant Protein (Rat)

RP214505 100 ug Ask for price

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Biotin.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with Cy3.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with FITC.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with HRP.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with PE.

Notch Regulated Ankyrin Repeat Protein (NRARP) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRARP (Gln3~Tyr109)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Notch Regulated Ankyrin Repeat Protein (NRARP). This antibody is labeled with APC-Cy7.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody

abx027512-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody

abx027512-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Notch Regulated Ankyrin Repeat Protein (NRARP) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody

abx432090-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nrarp ORF Vector (Rat) (pORF)

ORF071503 1.0 ug DNA
EUR 506

NRARP ORF Vector (Human) (pORF)

ORF007211 1.0 ug DNA
EUR 95

Nrarp ORF Vector (Mouse) (pORF)

ORF051656 1.0 ug DNA
EUR 506

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NOTCH Regulated Ankyrin Repeat Protein (NRARP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nrarp sgRNA CRISPR Lentivector set (Rat)

K6638101 3 x 1.0 ug
EUR 339

Nrarp sgRNA CRISPR Lentivector set (Mouse)

K3735501 3 x 1.0 ug
EUR 339

NRARP sgRNA CRISPR Lentivector set (Human)

K1453801 3 x 1.0 ug
EUR 339

Nrarp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6638102 1.0 ug DNA
EUR 154

NRARP Rabbit Polyclonal Antibody

Recent Posts


January 2022
