Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

SNAI3 Rabbit Polyclonal Antibody

SNAI3 Rabbit Polyclonal Antibody

Contact us: [email protected]

SNAI3 Polyclonal Antibody

ES11330-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SNAI3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SNAI3 Rabbit pAb

A17854-100ul 100 ul
EUR 308

SNAI3 Rabbit pAb

A17854-200ul 200 ul
EUR 459

SNAI3 Rabbit pAb

A17854-20ul 20 ul
EUR 183

SNAI3 Rabbit pAb

A17854-50ul 50 ul
EUR 223

SNAI3 Antibody

40110-100ul 100ul
EUR 252

SNAI3 Antibody

1-CSB-PA613772
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SNAI3 Antibody

1-CSB-PA558561
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI3. Recognizes SNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

SNAI3 Conjugated Antibody

C40110 100ul
EUR 397

anti- SNAI3 antibody

FNab08053 100µg
EUR 585
  • Immunogen: snail homolog 3(Drosophila)
  • Uniprot ID: Q3KNW1
  • Gene ID: 333929
  • Research Area: Metabolism
Description: Antibody raised against SNAI3

Anti-SNAI3 antibody

PAab08053 100 ug
EUR 412

Anti-SNAI3 Antibody

PB9440 100ug/vial
EUR 294

Anti-SNAI3 antibody

STJ119867 100 µl
EUR 277
Description: SNAI3 is a member of the SNAIL gene family, named for the Drosophila snail gene, which plays roles in mesodermal formation during embryogenesis (Katoh and Katoh, 2003 [PubMed 12579345]).[supplied by OMIM, Apr 2009]

Anti-SNAI3 antibody

STJ192488 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SNAI3

SNAI3 siRNA

20-abx934485
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SNAI3 siRNA

20-abx934486
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Zinc finger protein SNAI3, Snai3 ELISA KIT

ELI-18154m 96 Tests
EUR 865

Human Zinc finger protein SNAI3, SNAI3 ELISA KIT

ELI-53277h 96 Tests
EUR 824

SNAI3 cloning plasmid

CSB-CL660752HU-10ug 10ug
EUR 356
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: ATGCCGCGCTCCTTCCTGGTGAAAACGCACTCCAGCCACAGGGTCCCCAACTACCGGCGGCTGGAGACGCAGAGAGAAATCAATGGTGCCTGCTCTGCCTGTGGGGGGCTGGTGGTGCCCCTCCTCCCCCGAGACAAGGAGGCCCCTTCTGTGCCCGGTGACCTTCCCCAGCCCTG
  • Show more
Description: A cloning plasmid for the SNAI3 gene.

SNAI3 ELISA KIT|Human

EF003085 96 Tests
EUR 689

Human SNAI3 shRNA Plasmid

20-abx967203
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SNAI3 shRNA Plasmid

20-abx974042
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SNAI3 Recombinant Protein (Rat)

RP230204 100 ug Ask for price

pCR-BluntII-TOPO-SNAI3

PVT17972 2 ug
EUR 231

SNAI3 Recombinant Protein (Human)

RP043612 100 ug Ask for price

SNAI3 Recombinant Protein (Mouse)

RP174122 100 ug Ask for price

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody

20-abx210577
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody

abx238053-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Snail Family Transcriptional Repressor 3 (SNAI3) Antibody

20-abx339113
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snai3 ORF Vector (Rat) (pORF)

ORF076736 1.0 ug DNA
EUR 506

SNAI3 ORF Vector (Human) (pORF)

ORF014538 1.0 ug DNA
EUR 354

Snai3 ORF Vector (Mouse) (pORF)

ORF058042 1.0 ug DNA
EUR 506

Snai3 sgRNA CRISPR Lentivector set (Rat)

K6118401 3 x 1.0 ug
EUR 339

SNAI3 sgRNA CRISPR Lentivector set (Human)

K0003701 3 x 1.0 ug
EUR 339

Snai3 sgRNA CRISPR Lentivector set (Mouse)

K3940301 3 x 1.0 ug
EUR 339

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6118402 1.0 ug DNA
EUR 154

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6118403 1.0 ug DNA
EUR 154

Snai3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6118404 1.0 ug DNA
EUR 154

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0003702 1.0 ug DNA
EUR 154

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0003703 1.0 ug DNA
EUR 154

SNAI3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0003704 1.0 ug DNA
EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3940302 1.0 ug DNA
EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3940303 1.0 ug DNA
EUR 154

Snai3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3940304 1.0 ug DNA
EUR 154

SNAI3 Protein Vector (Rat) (pPB-C-His)

PV306942 500 ng
EUR 603

SNAI3 Protein Vector (Rat) (pPB-N-His)

PV306943 500 ng
EUR 603

SNAI3 Protein Vector (Rat) (pPM-C-HA)

PV306944 500 ng
EUR 603

SNAI3 Protein Vector (Rat) (pPM-C-His)

PV306945 500 ng
EUR 603

SNAI3 Protein Vector (Human) (pPB-C-His)

PV058149 500 ng
EUR 481

SNAI3 Protein Vector (Human) (pPB-N-His)

PV058150 500 ng
EUR 481

SNAI3 Protein Vector (Human) (pPM-C-HA)

PV058151 500 ng
EUR 481

SNAI3 Protein Vector (Human) (pPM-C-His)

PV058152 500 ng
EUR 481

SNAI3 Protein Vector (Mouse) (pPB-C-His)

PV232166 500 ng
EUR 603

SNAI3 Protein Vector (Mouse) (pPB-N-His)

PV232167 500 ng
EUR 603

SNAI3 Protein Vector (Mouse) (pPM-C-HA)

PV232168 500 ng
EUR 603

SNAI3 Protein Vector (Mouse) (pPM-C-His)

PV232169 500 ng
EUR 603

Snai3 3'UTR Luciferase Stable Cell Line

TU119366 1.0 ml Ask for price

Snai3 3'UTR GFP Stable Cell Line

TU169366 1.0 ml Ask for price

Snai3 3'UTR Luciferase Stable Cell Line

TU220874 1.0 ml Ask for price

Snai3 3'UTR GFP Stable Cell Line

TU270874 1.0 ml Ask for price

SNAI3 3'UTR GFP Stable Cell Line

TU073774 1.0 ml
EUR 1394

SNAI3 3'UTR Luciferase Stable Cell Line

TU023774 1.0 ml
EUR 1394

Human Snail Family Transcriptional Repressor 3 (SNAI3) ELISA Kit

abx383331-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

SNAI3 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages