EGFL7 Rabbit Polyclonal Antibody
Contact us: [email protected]
 EGFL7 Polyclonal Antibody |
|
ES11305-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against EGFL7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 EGFL7 Rabbit pAb |
|
A9376-100ul |
Abclonal |
100 ul |
EUR 308 |
EGFL7 Rabbit pAb |
|
A9376-200ul |
Abclonal |
200 ul |
EUR 459 |
EGFL7 Rabbit pAb |
|
A9376-20ul |
Abclonal |
20 ul |
EUR 183 |
EGFL7 Rabbit pAb |
|
A9376-50ul |
Abclonal |
50 ul |
EUR 223 |
 EGFL7 antibody |
|
70R-17016 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal EGFL7 antibody |
 EGFL7 Antibody |
|
35721-100ul |
SAB |
100ul |
EUR 252 |
EGFL7 Antibody |
|
1-CSB-PA890692LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
EGFL7 Antibody |
|
DF12391 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EGFL7 antibody detects endogenous levels of EGFL7. |
EGFL7 Antibody |
|
1-CSB-PA241758 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
EGFL7 Antibody |
|
1-CSB-PA007476GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 ELISA Kit) Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
DLR-EGFL7-Hu-48T |
DL Develop |
48T |
EUR 590 |
- Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
DLR-EGFL7-Hu-96T |
DL Develop |
96T |
EUR 774 |
- Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
DLR-EGFL7-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
DLR-EGFL7-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RDR-EGFL7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 631 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RDR-EGFL7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 880 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RDR-EGFL7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RDR-EGFL7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RD-EGFL7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RD-EGFL7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RD-EGFL7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit |
|
RD-EGFL7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
 EGFL7 Conjugated Antibody |
|
C35721 |
SAB |
100ul |
EUR 397 |
 anti- EGFL7 antibody |
|
FNab02666 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: EGF-like-domain, multiple 7
- Uniprot ID: Q9UHF1
- Gene ID: 51162
- Research Area: Cardiovascular, Developmental biology
|
|
Description: Antibody raised against EGFL7 |
 Anti-EGFL7 antibody |
|
STJ117865 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. |
Anti-EGFL7 antibody |
|
STJ192463 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to EGFL7 |
) Polyclonal Goat Anti-EGFL7 Antibody (internal region) |
|
AMM04962G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EGFL7 (internal region). This antibody is tested and proven to work in the following applications: |
 EGFL7 siRNA |
|
20-abx901654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGFL7 siRNA |
|
20-abx915065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGFL7 siRNA |
|
20-abx915066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-EGFL7 |
|
YF-PA18891 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to EGFL7 |
anti-EGFL7 |
|
YF-PA18892 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to EGFL7 |
anti-EGFL7 |
|
YF-PA26144 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to EGFL7 |
anti-EGFL7 |
|
YF-PA27553 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to EGFL7 |
 EGFL7 Antibody, HRP conjugated |
|
1-CSB-PA890692LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 EGFL7 Antibody, FITC conjugated |
|
1-CSB-PA890692LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 EGFL7 Antibody, Biotin conjugated |
|
1-CSB-PA890692LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 EGFL7 Blocking Peptide |
|
DF12391-BP |
Affbiotech |
1mg |
EUR 195 |
 EGFL7 cloning plasmid |
|
CSB-CL890692HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 822
- Sequence: atgaggggctctcaggaggtgctgctgatgtggcttctggtgttggcagtgggcggcacagagcacgcctaccggcccggccgtagggtgtgtgctgtccgggctcacggggaccctgtctccgagtcgttcgtgcagcgtgtgtaccagcccttcctcaccacctgcgacgggca
- Show more
|
|
Description: A cloning plasmid for the EGFL7 gene. |
) Anti-EGFL7 (2H6) |
|
YF-MA18426 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to EGFL7 |
) Anti-EGFL7 (3G1) |
|
YF-MA18427 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to EGFL7 |
 Polyclonal Antibody (Human)) EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human) |
|
4-PAL643Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7) |
 Polyclonal Antibody (Mouse)) EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse) |
|
4-PAL643Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Glu22~Leu275)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) |
 Rat EGFL7 shRNA Plasmid |
|
20-abx987913 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human EGFL7 shRNA Plasmid |
|
20-abx959573 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse EGFL7 shRNA Plasmid |
|
20-abx983708 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Polyclonal Antibody (Human), APC) EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC |
|
4-PAL643Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC. |
EGFL7 Rabbit Polyclonal Antibody
