Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

EGFL7 Rabbit Polyclonal Antibody

EGFL7 Rabbit Polyclonal Antibody

Contact us: [email protected]

EGFL7 Polyclonal Antibody

ES11305-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EGFL7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EGFL7 Rabbit pAb

A9376-100ul 100 ul
EUR 308

EGFL7 Rabbit pAb

A9376-200ul 200 ul
EUR 459

EGFL7 Rabbit pAb

A9376-20ul 20 ul
EUR 183

EGFL7 Rabbit pAb

A9376-50ul 50 ul
EUR 223

EGFL7 antibody

70R-17016 50 ul
EUR 435
Description: Rabbit polyclonal EGFL7 antibody

EGFL7 Antibody

35721-100ul 100ul
EUR 252

EGFL7 Antibody

1-CSB-PA890692LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

EGFL7 Antibody

DF12391 200ul
EUR 304
Description: EGFL7 antibody detects endogenous levels of EGFL7.

EGFL7 Antibody

1-CSB-PA241758
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

EGFL7 Antibody

1-CSB-PA007476GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Hu-48T 48T
EUR 590
  • Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Hu-96T 96T
EUR 774
  • Should the Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Mu-48T 48T
EUR 566
  • Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

DLR-EGFL7-Mu-96T 96T
EUR 741
  • Should the Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Hu-48Tests 48 Tests
EUR 631

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Hu-96Tests 96 Tests
EUR 880

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Mu-48Tests 48 Tests
EUR 603

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RDR-EGFL7-Mu-96Tests 96 Tests
EUR 840

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Hu-48Tests 48 Tests
EUR 603

Human EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Hu-96Tests 96 Tests
EUR 840

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Mu-48Tests 48 Tests
EUR 577

Mouse EGF Like Domain Protein, Multiple 7 (EGFL7) ELISA Kit

RD-EGFL7-Mu-96Tests 96 Tests
EUR 802

EGFL7 Conjugated Antibody

C35721 100ul
EUR 397

anti- EGFL7 antibody

FNab02666 100µg
EUR 505.25
  • Immunogen: EGF-like-domain, multiple 7
  • Uniprot ID: Q9UHF1
  • Gene ID: 51162
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against EGFL7

Anti-EGFL7 antibody

PAab02666 100 ug
EUR 355

Anti-EGFL7 antibody

STJ117865 100 µl
EUR 277
Description: This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants.

Anti-EGFL7 antibody

STJ73452 100 µg
EUR 359

Anti-EGFL7 antibody

STJ192463 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EGFL7

Egfl7/ Rat Egfl7 ELISA Kit

ELI-31539r 96 Tests
EUR 886

Polyclonal Goat Anti-EGFL7 Antibody (internal region)

AMM04962G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EGFL7 (internal region). This antibody is tested and proven to work in the following applications:

EGFL7 siRNA

20-abx901654
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EGFL7 siRNA

20-abx915065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EGFL7 siRNA

20-abx915066
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-EGFL7

YF-PA18891 100 ul
EUR 403
Description: Rabbit polyclonal to EGFL7

anti-EGFL7

YF-PA18892 100 ug
EUR 403
Description: Rabbit polyclonal to EGFL7

anti-EGFL7

YF-PA26144 50 ul
EUR 334
Description: Mouse polyclonal to EGFL7

anti-EGFL7

YF-PA27553 50 ug
EUR 363
Description: Mouse polyclonal to EGFL7

EGFL7 Antibody, HRP conjugated

1-CSB-PA890692LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EGFL7 Antibody, FITC conjugated

1-CSB-PA890692LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EGFL7 Antibody, Biotin conjugated

1-CSB-PA890692LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGFL7. Recognizes EGFL7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EGFL7 Blocking Peptide

DF12391-BP 1mg
EUR 195

EGFL7 cloning plasmid

CSB-CL890692HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgaggggctctcaggaggtgctgctgatgtggcttctggtgttggcagtgggcggcacagagcacgcctaccggcccggccgtagggtgtgtgctgtccgggctcacggggaccctgtctccgagtcgttcgtgcagcgtgtgtaccagcccttcctcaccacctgcgacgggca
  • Show more
Description: A cloning plasmid for the EGFL7 gene.

pCMV-SPORT6-EGFL7

PVT13643 2 ug
EUR 391

Anti-EGFL7 (2H6)

YF-MA18426 100 ug
EUR 363
Description: Mouse monoclonal to EGFL7

Anti-EGFL7 (3G1)

YF-MA18427 100 ug
EUR 363
Description: Mouse monoclonal to EGFL7

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human)

4-PAL643Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7)

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Mouse)

4-PAL643Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Glu22~Leu275)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse EGF Like Domain Protein, Multiple 7 (EGFL7)

Human EGFL7 ELISA Kit

ELA-E9193h 96 Tests
EUR 824

EGFL7 ELISA KIT|Human

EF006491 96 Tests
EUR 689

Rat EGFL7 shRNA Plasmid

20-abx987913
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EGFL7 shRNA Plasmid

20-abx959573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EGFL7 shRNA Plasmid

20-abx983708
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pEGFP-N1-EGFL7 Plasmid

PVTB00895-2a 2 ug
EUR 356

EGF Like Domain Protein, Multiple 7 (EGFL7) Polyclonal Antibody (Human), APC

4-PAL643Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EGFL7 (Tyr24~Ser273)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human EGF Like Domain Protein, Multiple 7 (EGFL7). This antibody is labeled with APC.

EGFL7 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages