Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


TBX6 Rabbit Polyclonal Antibody

TBX6 Rabbit Polyclonal Antibody

Contact us: [email protected]

TBX6 Polyclonal Antibody

ABP60637-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of TBX6 from Human, Mouse, Rat. This TBX6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TBX6 protein at amino acid sequence of 230-310

TBX6 Polyclonal Antibody

ES11218-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBX6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TBX6 Polyclonal Antibody

ES11218-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBX6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TBX6 Rabbit pAb

A16979-100ul 100 ul
EUR 308

TBX6 Rabbit pAb

A16979-200ul 200 ul
EUR 459

TBX6 Rabbit pAb

A16979-20ul 20 ul
EUR 183

TBX6 Rabbit pAb

A16979-50ul 50 ul
EUR 223

TBX6 antibody

70R-20729 50 ul
EUR 435
Description: Rabbit polyclonal TBX6 antibody

TBX6 Antibody

43507-100ul 100ul
EUR 252

TBX6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TBX6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal TBX6 Antibody (Center W158)

APR03597G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 (Center W158). This antibody is tested and proven to work in the following applications:

Polyclonal TBX6 antibody - N-terminal region

APR00629G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal TBX6 antibody - N-terminal region

APR00630G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBX6 - N-terminal region. This antibody is tested and proven to work in the following applications:

T-box 6 (TBX6) polyclonal antibody

ABP-PAB-11162 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

TBX6 Conjugated Antibody

C43507 100ul
EUR 397

anti- TBX6 antibody

FNab08542 100µg
EUR 548.75
  • Immunogen: T-box 6
  • Uniprot ID: O95947
  • Gene ID: 6911
  • Research Area: Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against TBX6

Anti-TBX6 antibody

PAab08542 100 ug
EUR 386

Anti-TBX6 antibody

STJ119283 100 µl
EUR 277

Anti-TBX6 antibody

STJ192376 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TBX6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBX6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBX6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBX6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBX6. Recognizes TBX6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TBX6 cloning plasmid

CSB-CL023258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1311
  • Sequence: atgtaccatccacgagaattgtacccgtccctgggggccggctaccgcctggggcccgcccaacctggggccgactccagcttcccacccgccctagcggagggctaccgctaccccgaactggacacccctaaactggattgcttcctctccgggatggaggctgctccccgca
  • Show more
Description: A cloning plasmid for the TBX6 gene.

Anti-TBX6 (2D11)

YF-MA15744 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3D6)

YF-MA15745 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F6)

YF-MA15746 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (1D11)

YF-MA15747 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3G9)

YF-MA15748 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F8)

YF-MA15749 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

Anti-TBX6 (3F11)

YF-MA15750 100 ug
EUR 363
Description: Mouse monoclonal to TBX6

T-Box 6 (TBX6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse T- box transcription factor TBX6, Tbx6 ELISA KIT

ELI-53153m 96 Tests
EUR 865

Human T- box transcription factor TBX6, TBX6 ELISA KIT

ELI-46478h 96 Tests
EUR 824

T-Box Protein 6 (TBX6) Antibody

abx026378-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

abx026378-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

abx026525-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

abx026525-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

abx122846-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody

abx238542-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

T-Box Protein 6 (TBX6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF003487 96 Tests
EUR 689

Rat TBX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TBX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TBX6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TBX6 Recombinant Protein (Rat)

RP232541 100 ug Ask for price

TBX6 Recombinant Protein (Human)

RP031096 100 ug Ask for price

TBX6 Recombinant Protein (Mouse)

RP177695 100 ug Ask for price

T-Box Protein 6 (TBX6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Box Protein 6 (TBX6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal TBX6 Antibody (monoclonal) (M06), Clone: 1D11

AMM04176G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IF

Monoclonal TBX6 Antibody (monoclonal) (M08), Clone: 3G9

AMM04177G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TBX6 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E

Tbx6 ORF Vector (Rat) (pORF)

ORF077515 1.0 ug DNA
EUR 506

TBX6 ORF Vector (Human) (pORF)

ORF010366 1.0 ug DNA
EUR 95

Tbx6 ORF Vector (Mouse) (pORF)

ORF059233 1.0 ug DNA
EUR 506

Tbx6 sgRNA CRISPR Lentivector set (Rat)

K6168801 3 x 1.0 ug
EUR 339

TBX6 sgRNA CRISPR Lentivector set (Human)

K2344601 3 x 1.0 ug
EUR 339

Tbx6 sgRNA CRISPR Lentivector set (Mouse)

K3972501 3 x 1.0 ug
EUR 339

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6168802 1.0 ug DNA
EUR 154

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6168803 1.0 ug DNA
EUR 154

Tbx6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6168804 1.0 ug DNA
EUR 154

TBX6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2344602 1.0 ug DNA
EUR 154

TBX6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2344603 1.0 ug DNA
EUR 154

TBX6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2344604 1.0 ug DNA
EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3972502 1.0 ug DNA
EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3972503 1.0 ug DNA
EUR 154

Tbx6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3972504 1.0 ug DNA
EUR 154

TBX6 3'UTR Luciferase Stable Cell Line

TU025252 1.0 ml
EUR 1394

Tbx6 3'UTR Luciferase Stable Cell Line

TU120247 1.0 ml Ask for price

Tbx6 3'UTR GFP Stable Cell Line

TU170247 1.0 ml Ask for price

Tbx6 3'UTR Luciferase Stable Cell Line

TU221676 1.0 ml Ask for price

TBX6 3'UTR GFP Stable Cell Line

TU075252 1.0 ml
EUR 1394

Tbx6 3'UTR GFP Stable Cell Line

TU271676 1.0 ml Ask for price

TBX6 Protein Vector (Rat) (pPB-C-His)

PV310058 500 ng
EUR 603

TBX6 Protein Vector (Rat) (pPB-N-His)

PV310059 500 ng
EUR 603

TBX6 Protein Vector (Rat) (pPM-C-HA)

PV310060 500 ng
EUR 603

TBX6 Protein Vector (Rat) (pPM-C-His)

PV310061 500 ng
EUR 603

TBX6 Protein Vector (Human) (pPB-C-His)

PV041461 500 ng
EUR 329

TBX6 Protein Vector (Human) (pPB-N-His)

PV041462 500 ng
EUR 329

TBX6 Protein Vector (Human) (pPM-C-HA)

PV041463 500 ng
EUR 329

TBX6 Protein Vector (Human) (pPM-C-His)

PV041464 500 ng
EUR 329

TBX6 Protein Vector (Mouse) (pPB-C-His)

PV236930 500 ng
EUR 603

TBX6 Protein Vector (Mouse) (pPB-N-His)

PV236931 500 ng
EUR 603

TBX6 Protein Vector (Mouse) (pPM-C-HA)

PV236932 500 ng
EUR 603

TBX6 Protein Vector (Mouse) (pPM-C-His)

PV236933 500 ng
EUR 603

Human T-Box Protein 6 (TBX6)ELISA Kit

201-12-2597 96 tests
EUR 440
  • This T-Box Protein 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human T-Box protein 6 (TBX6) ELISA Kit

abx383663-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human T-Box Protein 6(TBX6)ELISA Kit

QY-E04514 96T
EUR 394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

TBX6 Rabbit Polyclonal Antibody

Recent Posts


January 2022
