RAP1A Rabbit Polyclonal Antibody
Contact us: [email protected]
 RAP1A Polyclonal Antibody |
|
ES11127-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAP1A Polyclonal Antibody |
|
ES11127-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 RAP1A Rabbit pAb |
|
A0975-100ul |
Abclonal |
100 ul |
EUR 308 |
RAP1A Rabbit pAb |
|
A0975-200ul |
Abclonal |
200 ul |
EUR 459 |
RAP1A Rabbit pAb |
|
A0975-20ul |
Abclonal |
20 ul |
EUR 183 |
RAP1A Rabbit pAb |
|
A0975-50ul |
Abclonal |
50 ul |
EUR 223 |
 RAP1A antibody |
|
22245-100ul |
SAB |
100ul |
EUR 390 |
RAP1A antibody |
|
70R-19768 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RAP1A antibody |
 RAP1A Antibody |
|
35640-100ul |
SAB |
100ul |
EUR 252 |
RAP1A antibody |
|
38156-100ul |
SAB |
100ul |
EUR 252 |
RAP1A Antibody |
|
1-CSB-PA827156 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
RAP1A Antibody |
|
1-CSB-PA968243 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
RAP1A Antibody |
|
DF6157 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAP1A Antibody detects endogenous levels of total RAP1A. |
RAP1A antibody |
|
70R-51010 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RAP1A antibody |
RAP1A Antibody |
|
BF0304 |
Affbiotech |
200ul |
EUR 376 |
|
Description: RAP1A antibody detects endogenous levels of total RAP1A. |
RAP1A Antibody |
|
1-CSB-PA019321GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
RAP1A Antibody |
|
1-CSB-PA019321LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 Polyclonal Rap1a Antibody - middle region |
|
AMM07522G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - middle region. This antibody is tested and proven to work in the following applications: |
 RAP1A Polyclonal Antibody, Biotin Conjugated |
|
A60519 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 RAP1A Polyclonal Antibody, FITC Conjugated |
|
A60520 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 RAP1A Polyclonal Antibody, HRP Conjugated |
|
A60521 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 Polyclonal Rap1a Antibody - C-terminal region |
|
AMM07521G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - C-terminal region. This antibody is tested and proven to work in the following applications: |
 RAP1A Conjugated Antibody |
|
C35640 |
SAB |
100ul |
EUR 397 |
 Anti-RAP1A Antibody |
|
PB9816 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-RAP1A antibody |
|
STJ25296 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. |
Anti-RAP1A antibody |
|
STJ192285 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RAP1A |
 RAP1A siRNA |
|
20-abx904462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A siRNA |
|
20-abx930868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A siRNA |
|
20-abx930869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RAP1A |
|
YF-PA24544 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RAP1A |
 RAP1A Antibody, HRP conjugated |
|
1-CSB-PA019321LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RAP1A Antibody, FITC conjugated |
|
1-CSB-PA019321LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RAP1A Antibody, Biotin conjugated |
|
1-CSB-PA019321LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ELISA Kit) Human Ras-related protein Rap1A (RAP1A) ELISA Kit |
|
abx251608-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 RAP1A Blocking Peptide |
|
DF6157-BP |
Affbiotech |
1mg |
EUR 195 |
RAP1A Blocking Peptide |
|
20-abx063885 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAP1A Blocking Peptide |
|
BF0304-BP |
Affbiotech |
1mg |
EUR 195 |
 RAP1A cloning plasmid |
|
CSB-CL019321HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: atgcgtgagtacaagctagtggtccttggttcaggaggcgttgggaagtctgctctgacagttcagtttgttcagggaatttttgttgaaaaatatgacccaacgatagaagattcctacagaaagcaagttgaagtcgattgccaacagtgtatgctcgaaatcctggatactgc
- Show more
|
|
Description: A cloning plasmid for the RAP1A gene. |
) anti-RAP1A (5F8) |
|
LF-MA30709 |
Abfrontier |
100 ul |
EUR 527 |
|
Description: Mouse Monoclonal to RAP1A |
) anti-RAP1A (5F8G2) |
|
LF-MA30710 |
Abfrontier |
100 ul |
EUR 527 |
|
Description: Mouse Monoclonal to RAP1A |
 Recombinant Human Rap1a |
|
STA-735 |
Cell Biolabs |
10 µg |
EUR 276 |
Description: - Recombinant Human Rap1a is expressed in E. coli and contains a His tag at the N-terminus. 10 µg/vial.
- Recombinant protein is raised in E. coli
- Protein includes a tag
- Recombinant Protein purified from E. coli
|
) Anti-RAP1A (3E1) |
|
YF-MA15102 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RAP1A |
 Monoclonal RAP1A Antibody, Clone: 5F8 |
|
AMM02891G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human RAP1A. The antibodies are raised in Mouse and are from clone 5F8. This antibody is applicable in WB, FC, E |
) RAP1A protein (His tag) |
|
80R-1361 |
Fitzgerald |
50 ug |
EUR 397 |
|
Description: Purified recombinant Human RAP1A protein |
 Rat RAP1A shRNA Plasmid |
|
20-abx988754 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RAP1A Rabbit Polyclonal Antibody
