Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

RAP1A Rabbit Polyclonal Antibody

RAP1A Rabbit Polyclonal Antibody

Contact us: [email protected]

RAP1A Polyclonal Antibody

ES11127-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1A Polyclonal Antibody

ES11127-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAP1A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAP1A Rabbit pAb

A0975-100ul 100 ul
EUR 308

RAP1A Rabbit pAb

A0975-200ul 200 ul
EUR 459

RAP1A Rabbit pAb

A0975-20ul 20 ul
EUR 183

RAP1A Rabbit pAb

A0975-50ul 50 ul
EUR 223

RAP1A antibody

22245-100ul 100ul
EUR 390

RAP1A antibody

70R-19768 50 ul
EUR 435
Description: Rabbit polyclonal RAP1A antibody

RAP1A Antibody

35640-100ul 100ul
EUR 252

RAP1A antibody

38156-100ul 100ul
EUR 252

RAP1A Antibody

1-CSB-PA827156
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RAP1A Antibody

1-CSB-PA968243
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

RAP1A Antibody

DF6157 200ul
EUR 304
Description: RAP1A Antibody detects endogenous levels of total RAP1A.

RAP1A antibody

70R-51010 100 ul
EUR 244
Description: Purified Polyclonal RAP1A antibody

RAP1A Antibody

BF0304 200ul
EUR 376
Description: RAP1A antibody detects endogenous levels of total RAP1A.

RAP1A Antibody

1-CSB-PA019321GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

RAP1A Antibody

1-CSB-PA019321LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAP1A Antibody

ABD6157 100 ug
EUR 438

Polyclonal Rap1a Antibody - middle region

AMM07522G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - middle region. This antibody is tested and proven to work in the following applications:

RAP1A Polyclonal Antibody, Biotin Conjugated

A60519 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAP1A Polyclonal Antibody, FITC Conjugated

A60520 100 µg
EUR 570.55
Description: fast delivery possible

RAP1A Polyclonal Antibody, HRP Conjugated

A60521 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal Rap1a Antibody - C-terminal region

AMM07521G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rap1a - C-terminal region. This antibody is tested and proven to work in the following applications:

RAP1A Conjugated Antibody

C35640 100ul
EUR 397

Anti-RAP1A Antibody

PB9816 100ug/vial
EUR 294

Anti-RAP1A antibody

STJ25296 100 µl
EUR 277
Description: This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants.

Anti-RAP1A antibody

STJ192285 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAP1A

RAP1A siRNA

20-abx904462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAP1A siRNA

20-abx930868
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAP1A siRNA

20-abx930869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAP1A

YF-PA24544 50 ul
EUR 334
Description: Mouse polyclonal to RAP1A

RAP1A Antibody, HRP conjugated

1-CSB-PA019321LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAP1A Antibody, FITC conjugated

1-CSB-PA019321LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAP1A Antibody, Biotin conjugated

1-CSB-PA019321LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAP1A. Recognizes RAP1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Ras-related protein Rap1A (RAP1A) ELISA Kit

abx251608-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

RAP1A Blocking Peptide

DF6157-BP 1mg
EUR 195

RAP1A Blocking Peptide

20-abx063885
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAP1A Blocking Peptide

BF0304-BP 1mg
EUR 195

RAP1A cloning plasmid

CSB-CL019321HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgcgtgagtacaagctagtggtccttggttcaggaggcgttgggaagtctgctctgacagttcagtttgttcagggaatttttgttgaaaaatatgacccaacgatagaagattcctacagaaagcaagttgaagtcgattgccaacagtgtatgctcgaaatcctggatactgc
  • Show more
Description: A cloning plasmid for the RAP1A gene.

anti-RAP1A (5F8)

LF-MA30709 100 ul
EUR 527
Description: Mouse Monoclonal to RAP1A

anti-RAP1A (5F8G2)

LF-MA30710 100 ul
EUR 527
Description: Mouse Monoclonal to RAP1A

Recombinant Human Rap1a

STA-735 10 µg
EUR 276
Description:
  • Recombinant Human Rap1a is expressed in E. coli and contains a His tag at the N-terminus. 10 µg/vial.
  • Recombinant protein is raised in E. coli
  • Protein includes a tag
  • Recombinant Protein purified from E. coli

Anti-RAP1A (3E1)

YF-MA15102 100 ug
EUR 363
Description: Mouse monoclonal to RAP1A

Monoclonal RAP1A Antibody, Clone: 5F8

AMM02891G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RAP1A. The antibodies are raised in Mouse and are from clone 5F8. This antibody is applicable in WB, FC, E

RAP1A protein (His tag)

80R-1361 50 ug
EUR 397
Description: Purified recombinant Human RAP1A protein

Human RAP1A ELISA Kit

ELA-E3220h 96 Tests
EUR 824

RAP1A ELISA KIT|Human

EF006324 96 Tests
EUR 689

Rat RAP1A shRNA Plasmid

20-abx988754
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAP1A Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages