Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

MFSD8 Rabbit Polyclonal Antibody

MFSD8 Rabbit Polyclonal Antibody

Contact us: [email protected]

MFSD8 Polyclonal Antibody
ABP59268-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
  • Applications tips:
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
MFSD8 Polyclonal Antibody
ABP59268-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
  • Applications tips:
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
MFSD8 Polyclonal Antibody
ABP59268-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
  • Applications tips:
Description: A polyclonal antibody for detection of MFSD8 from Human. This MFSD8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MFSD8 protein at amino acid sequence of 351-400
MFSD8 Polyclonal Antibody
ES11413-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MFSD8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MFSD8 Polyclonal Antibody
ES11413-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MFSD8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MFSD8 Antibody
1-CSB-PA844087LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
MFSD8 antibody
70R-9335 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MFSD8 antibody
Polyclonal MFSD8 antibody - middle region
APR17366G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFSD8 - middle region. This antibody is tested and proven to work in the following applications:
MFSD8 Polyclonal Antibody, HRP Conjugated
A66783 100 µg
EUR 570.55
Description: Ask the seller for details
MFSD8 Polyclonal Antibody, FITC Conjugated
A66784 100 µg
EUR 570.55
Description: The best epigenetics products
MFSD8 Polyclonal Antibody, Biotin Conjugated
A66785 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- MFSD8 antibody
FNab05155 100µg
EUR 548.75
  • Immunogen: major facilitator superfamily domain containing 8
  • Uniprot ID: Q8NHS3
  • Gene ID: 256471
  • Research Area: Signal Transduction
Description: Antibody raised against MFSD8
Anti-MFSD8 antibody
PAab05155 100 ug
EUR 386
Anti-MFSD8 antibody
STJ192571 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MFSD8
MFSD8 siRNA
20-abx924072
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MFSD8 siRNA
20-abx924073
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MFSD8 Antibody, HRP conjugated
1-CSB-PA844087LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MFSD8 Antibody, FITC conjugated
1-CSB-PA844087LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MFSD8 Antibody, Biotin conjugated
1-CSB-PA844087LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFSD8. Recognizes MFSD8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
MFSD8 Blocking Peptide
33R-2891 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFSD8 antibody, catalog no. 70R-9335
MFSD8 cloning plasmid
CSB-CL844087HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggccggcctgcggaacgaaagtgaacaggagccgctcttaggcgacacacctggaagcagagaatgggacattttagagactgaagagcattataagagccgatggagatctattaggattttatatcttactatgtttctcagcagtgtagggttttctgtagtgatgatgt
  • Show more
Description: A cloning plasmid for the MFSD8 gene.
Human MFSD8 ELISA KIT
ELI-14023h 96 Tests
EUR 824
Mouse Mfsd8 ELISA KIT
ELI-19506m 96 Tests
EUR 865
MFSD8 ELISA KIT|Human
EF000770 96 Tests
EUR 689
Mouse MFSD8 shRNA Plasmid
20-abx977704
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human MFSD8 shRNA Plasmid
20-abx966758
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MFSD8 Recombinant Protein (Human)
RP019285 100 ug Ask for price
MFSD8 Recombinant Protein (Mouse)
RP150473 100 ug Ask for price
MFSD8 Recombinant Protein (Rat)
RP211562 100 ug Ask for price
Mfsd8 ORF Vector (Rat) (pORF)
ORF070522 1.0 ug DNA
EUR 506
MFSD8 ORF Vector (Human) (pORF)
ORF006429 1.0 ug DNA
EUR 95
Mfsd8 ORF Vector (Mouse) (pORF)
ORF050159 1.0 ug DNA
EUR 506
Major Facilitator Superfamily Domain Containing 8 (MFSD8) Antibody
abx235155-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Major Facilitator Superfamily Domain Containing 8 (MFSD8) Antibody
20-abx302028
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mfsd8 sgRNA CRISPR Lentivector set (Rat)
K6147801 3 x 1.0 ug
EUR 339
MFSD8 sgRNA CRISPR Lentivector set (Human)
K1297601 3 x 1.0 ug
EUR 339
Mfsd8 sgRNA CRISPR Lentivector set (Mouse)
K4050101 3 x 1.0 ug
EUR 339
Major Facilitator Superfamily Domain Containing 8 (MFSD8) Antibody (HRP)
20-abx309727
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Facilitator Superfamily Domain Containing 8 (MFSD8) Antibody (FITC)
20-abx309728
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Facilitator Superfamily Domain Containing 8 (MFSD8) Antibody (Biotin)
20-abx309729
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mfsd8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6147802 1.0 ug DNA
EUR 154
Mfsd8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6147803 1.0 ug DNA
EUR 154
Mfsd8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6147804 1.0 ug DNA
EUR 154
MFSD8 sgRNA CRISPR Lentivector (Human) (Target 1)
K1297602 1.0 ug DNA
EUR 154
MFSD8 sgRNA CRISPR Lentivector (Human) (Target 2)
K1297603 1.0 ug DNA
EUR 154
MFSD8 sgRNA CRISPR Lentivector (Human) (Target 3)
K1297604 1.0 ug DNA
EUR 154
Mfsd8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4050102 1.0 ug DNA
EUR 154
Mfsd8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4050103 1.0 ug DNA
EUR 154
Mfsd8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4050104 1.0 ug DNA
EUR 154
MFSD8 Protein Vector (Mouse) (pPB-C-His)
PV200634 500 ng
EUR 603
MFSD8 Protein Vector (Mouse) (pPB-N-His)
PV200635 500 ng
EUR 603
MFSD8 Protein Vector (Mouse) (pPM-C-HA)
PV200636 500 ng
EUR 603
MFSD8 Protein Vector (Mouse) (pPM-C-His)
PV200637 500 ng
EUR 603
MFSD8 Protein Vector (Rat) (pPB-C-His)
PV282086 500 ng
EUR 603
MFSD8 Protein Vector (Rat) (pPB-N-His)
PV282087 500 ng
EUR 603
MFSD8 Protein Vector (Rat) (pPM-C-HA)
PV282088 500 ng
EUR 603
MFSD8 Protein Vector (Rat) (pPM-C-His)
PV282089 500 ng
EUR 603
MFSD8 Protein Vector (Human) (pPB-C-His)
PV025713 500 ng
EUR 329
MFSD8 Protein Vector (Human) (pPB-N-His)
PV025714 500 ng
EUR 329
MFSD8 Protein Vector (Human) (pPM-C-HA)
PV025715 500 ng
EUR 329
MFSD8 Protein Vector (Human) (pPM-C-His)
PV025716 500 ng
EUR 329
Mfsd8 3'UTR Luciferase Stable Cell Line
TU113162 1.0 ml Ask for price
Mfsd8 3'UTR GFP Stable Cell Line
TU163162 1.0 ml Ask for price
Mfsd8 3'UTR Luciferase Stable Cell Line
TU213124 1.0 ml Ask for price
Mfsd8 3'UTR GFP Stable Cell Line
TU263124 1.0 ml Ask for price
MFSD8 3'UTR GFP Stable Cell Line
TU063308 1.0 ml
EUR 1521
MFSD8 3'UTR Luciferase Stable Cell Line
TU013308 1.0 ml
EUR 1521
Recombinant Human MFSD8 Protein, His-GST, E.coli-100ug
QP7922-ec-100ug 100ug
EUR 571
Recombinant Human MFSD8 Protein, His-GST, E.coli-10ug
QP7922-ec-10ug 10ug
EUR 272
Recombinant Human MFSD8 Protein, His-GST, E.coli-1mg
QP7922-ec-1mg 1mg
EUR 2303
Recombinant Human MFSD8 Protein, His-GST, E.coli-200ug
QP7922-ec-200ug 200ug
EUR 898
Recombinant Human MFSD8 Protein, His-GST, E.coli-500ug
QP7922-ec-500ug 500ug
EUR 1514
Recombinant Human MFSD8 Protein, His-GST, E.coli-50ug
QP7922-ec-50ug 50ug
EUR 362
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

MFSD8 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages