CPXM1 Rabbit Polyclonal Antibody
Contact us: [email protected]
 CPXM1 Polyclonal Antibody |
|
ABP58257-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CPXM1 from Human, Mouse. This CPXM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430 |
CPXM1 Polyclonal Antibody |
|
ES11178-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CPXM1 Polyclonal Antibody |
|
ES11178-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 CPXM1 Rabbit pAb |
|
A16552-100ul |
Abclonal |
100 ul |
EUR 308 |
CPXM1 Rabbit pAb |
|
A16552-200ul |
Abclonal |
200 ul |
EUR 459 |
CPXM1 Rabbit pAb |
|
A16552-20ul |
Abclonal |
20 ul |
EUR 183 |
CPXM1 Rabbit pAb |
|
A16552-50ul |
Abclonal |
50 ul |
EUR 223 |
 CPXM1 Polyclonal Conjugated Antibody |
|
C29878 |
SAB |
100ul |
EUR 397 |
 Polyclonal CPXM1 antibody - middle region |
|
APR01354G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPXM1 - middle region. This antibody is tested and proven to work in the following applications: |
 Anti-CPXM1 antibody |
|
STJ192336 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CPXM1 |
 CPXM1 siRNA |
|
20-abx912730 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CPXM1 siRNA |
|
20-abx912731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CPXM1 cloning plasmid |
|
CSB-CL836302HU-10ug |
Cusabio |
10ug |
EUR 409 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1071
- Sequence: atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacggga
- Show more
|
|
Description: A cloning plasmid for the CPXM1 gene. |
 Mouse CPXM1 shRNA Plasmid |
|
20-abx974668 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CPXM1 shRNA Plasmid |
|
20-abx961124 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CPXM1 Recombinant Protein (Human) |
|
RP007936 |
ABM |
100 ug |
Ask for price |
) CPXM1 Recombinant Protein (Rat) |
|
RP196187 |
ABM |
100 ug |
Ask for price |
) CPXM1 Recombinant Protein (Mouse) |
|
RP125870 |
ABM |
100 ug |
Ask for price |
 (pORF)) Cpxm1 ORF Vector (Rat) (pORF) |
|
ORF065397 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CPXM1 ORF Vector (Human) (pORF) |
|
ORF002646 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Cpxm1 ORF Vector (Mouse) (pORF) |
|
ORF041958 |
ABM |
1.0 ug DNA |
EUR 506 |
) CPXM1 sgRNA CRISPR Lentivector set (Human) |
|
K0503401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cpxm1 sgRNA CRISPR Lentivector set (Rat) |
|
K6223001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cpxm1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3817201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Human Probable carboxypeptidase X1, CPXM1 ELISA KIT |
|
ELI-50458h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Probable carboxypeptidase X1, Cpxm1 ELISA KIT |
|
ELI-50582m |
Lifescience Market |
96 Tests |
EUR 865 |
 (Target 1)) CPXM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0503402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CPXM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0503403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CPXM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0503404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6223002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6223003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6223004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3817202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3817203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3817204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CPXM1 Protein Vector (Mouse) (pPB-C-His) |
|
PV167830 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) CPXM1 Protein Vector (Mouse) (pPB-N-His) |
|
PV167831 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) CPXM1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV167832 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) CPXM1 Protein Vector (Mouse) (pPM-C-His) |
|
PV167833 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) CPXM1 Protein Vector (Rat) (pPB-C-His) |
|
PV261586 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) CPXM1 Protein Vector (Rat) (pPB-N-His) |
|
PV261587 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) CPXM1 Protein Vector (Rat) (pPM-C-HA) |
|
PV261588 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) CPXM1 Protein Vector (Rat) (pPM-C-His) |
|
PV261589 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) CPXM1 Protein Vector (Human) (pPB-C-His) |
|
PV010581 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CPXM1 Protein Vector (Human) (pPB-N-His) |
|
PV010582 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CPXM1 Protein Vector (Human) (pPM-C-HA) |
|
PV010583 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CPXM1 Protein Vector (Human) (pPM-C-His) |
|
PV010584 |
ABM |
500 ng |
EUR 329 |
 Cpxm1 3'UTR GFP Stable Cell Line |
|
TU154329 |
ABM |
1.0 ml |
Ask for price |
 Cpxm1 3'UTR Luciferase Stable Cell Line |
|
TU104329 |
ABM |
1.0 ml |
Ask for price |
Cpxm1 3'UTR Luciferase Stable Cell Line |
|
TU202758 |
ABM |
1.0 ml |
Ask for price |
Cpxm1 3'UTR GFP Stable Cell Line |
|
TU252758 |
ABM |
1.0 ml |
Ask for price |
 CPXM1 3'UTR GFP Stable Cell Line |
|
TU054977 |
ABM |
1.0 ml |
EUR 1394 |
 CPXM1 3'UTR Luciferase Stable Cell Line |
|
TU004977 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) CPXM1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV655039 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) CPXM1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV655043 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) CPXM1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV655044 |
ABM |
1.0 ug DNA |
EUR 1355 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
CPXM1 Rabbit Polyclonal Antibody
