Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

CPXM1 Rabbit Polyclonal Antibody

CPXM1 Rabbit Polyclonal Antibody

Contact us: [email protected]

CPXM1 Polyclonal Antibody

ABP58257-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of CPXM1 from Human, Mouse. This CPXM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CPXM1 protein at amino acid sequence of 350-430

CPXM1 Polyclonal Antibody

ES11178-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPXM1 Polyclonal Antibody

ES11178-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CPXM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPXM1 Rabbit pAb

A16552-100ul 100 ul
EUR 308

CPXM1 Rabbit pAb

A16552-200ul 200 ul
EUR 459

CPXM1 Rabbit pAb

A16552-20ul 20 ul
EUR 183

CPXM1 Rabbit pAb

A16552-50ul 50 ul
EUR 223

CPXM1 Polyclonal Conjugated Antibody

C29878 100ul
EUR 397

Polyclonal CPXM1 antibody - middle region

APR01354G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPXM1 - middle region. This antibody is tested and proven to work in the following applications:

Anti-CPXM1 antibody

STJ118991 100 µl
EUR 277

Anti-CPXM1 antibody

STJ192336 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CPXM1

CPXM1 siRNA

20-abx912730
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPXM1 siRNA

20-abx912731
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPXM1 cloning plasmid

CSB-CL836302HU-10ug 10ug
EUR 409
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacggga
  • Show more
Description: A cloning plasmid for the CPXM1 gene.

Mouse CPXM1 shRNA Plasmid

20-abx974668
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CPXM1 shRNA Plasmid

20-abx961124
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPXM1 Recombinant Protein (Human)

RP007936 100 ug Ask for price

CPXM1 Recombinant Protein (Rat)

RP196187 100 ug Ask for price

CPXM1 Recombinant Protein (Mouse)

RP125870 100 ug Ask for price

Cpxm1 ORF Vector (Rat) (pORF)

ORF065397 1.0 ug DNA
EUR 506

CPXM1 ORF Vector (Human) (pORF)

ORF002646 1.0 ug DNA
EUR 95

Cpxm1 ORF Vector (Mouse) (pORF)

ORF041958 1.0 ug DNA
EUR 506

CPXM1 sgRNA CRISPR Lentivector set (Human)

K0503401 3 x 1.0 ug
EUR 339

Cpxm1 sgRNA CRISPR Lentivector set (Rat)

K6223001 3 x 1.0 ug
EUR 339

Cpxm1 sgRNA CRISPR Lentivector set (Mouse)

K3817201 3 x 1.0 ug
EUR 339

Human Probable carboxypeptidase X1, CPXM1 ELISA KIT

ELI-50458h 96 Tests
EUR 824

Mouse Probable carboxypeptidase X1, Cpxm1 ELISA KIT

ELI-50582m 96 Tests
EUR 865

CPXM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0503402 1.0 ug DNA
EUR 154

CPXM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0503403 1.0 ug DNA
EUR 154

CPXM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0503404 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6223002 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6223003 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6223004 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3817202 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3817203 1.0 ug DNA
EUR 154

Cpxm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3817204 1.0 ug DNA
EUR 154

CPXM1 Protein Vector (Mouse) (pPB-C-His)

PV167830 500 ng
EUR 1065

CPXM1 Protein Vector (Mouse) (pPB-N-His)

PV167831 500 ng
EUR 1065

CPXM1 Protein Vector (Mouse) (pPM-C-HA)

PV167832 500 ng
EUR 1065

CPXM1 Protein Vector (Mouse) (pPM-C-His)

PV167833 500 ng
EUR 1065

CPXM1 Protein Vector (Rat) (pPB-C-His)

PV261586 500 ng
EUR 1166

CPXM1 Protein Vector (Rat) (pPB-N-His)

PV261587 500 ng
EUR 1166

CPXM1 Protein Vector (Rat) (pPM-C-HA)

PV261588 500 ng
EUR 1166

CPXM1 Protein Vector (Rat) (pPM-C-His)

PV261589 500 ng
EUR 1166

CPXM1 Protein Vector (Human) (pPB-C-His)

PV010581 500 ng
EUR 329

CPXM1 Protein Vector (Human) (pPB-N-His)

PV010582 500 ng
EUR 329

CPXM1 Protein Vector (Human) (pPM-C-HA)

PV010583 500 ng
EUR 329

CPXM1 Protein Vector (Human) (pPM-C-His)

PV010584 500 ng
EUR 329

Cpxm1 3'UTR GFP Stable Cell Line

TU154329 1.0 ml Ask for price

Cpxm1 3'UTR Luciferase Stable Cell Line

TU104329 1.0 ml Ask for price

Cpxm1 3'UTR Luciferase Stable Cell Line

TU202758 1.0 ml Ask for price

Cpxm1 3'UTR GFP Stable Cell Line

TU252758 1.0 ml Ask for price

CPXM1 3'UTR GFP Stable Cell Line

TU054977 1.0 ml
EUR 1394

CPXM1 3'UTR Luciferase Stable Cell Line

TU004977 1.0 ml
EUR 1394

CPXM1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV655039 1.0 ug DNA
EUR 1355

CPXM1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV655043 1.0 ug DNA
EUR 1355

CPXM1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV655044 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

CPXM1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages