Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


WNT2 Rabbit Polyclonal Antibody

WNT2 Rabbit Polyclonal Antibody

Contact us: [email protected]

WNT2 Polyclonal Antibody

ES11300-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WNT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WNT2 Rabbit pAb

A13562-100ul 100 ul
EUR 308

WNT2 Rabbit pAb

A13562-200ul 200 ul
EUR 459

WNT2 Rabbit pAb

A13562-20ul 20 ul
EUR 183

WNT2 Rabbit pAb

A13562-50ul 50 ul
EUR 223

WNT2 Rabbit pAb

A5864-100ul 100 ul
EUR 308

WNT2 Rabbit pAb

A5864-200ul 200 ul
EUR 459

WNT2 Rabbit pAb

A5864-20ul 20 ul
EUR 183

WNT2 Rabbit pAb

A5864-50ul 50 ul
EUR 223

Anti-WNT2 Rabbit Monoclonal Antibody

M03226 100ug/vial
EUR 397
Description: Rabbit Monoclonal WNT2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Wnt2 antibody

70R-11919 100 ug
EUR 460
Description: Rabbit polyclonal Wnt2 antibody

WNT2 antibody

70R-21324 50 ul
EUR 435
Description: Rabbit polyclonal WNT2 antibody

WNT2 antibody

38699-100ul 100ul
EUR 252

WNT2 Antibody

43192-100ul 100ul
EUR 252

WNT2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

WNT2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150

WNT2 Antibody

DF8067 200ul
EUR 304
Description: WNT2 Antibody detects endogenous levels of total WNT2.

WNT2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

WNT2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against WNT2. Recognizes WNT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

WNT2 antibody

70R-5380 50 ug
EUR 467
Description: Rabbit polyclonal WNT2 antibody raised against the middle region of WNT2

WNT2 Antibody

ABD8067 100 ug
EUR 438

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

DLR-WNT2-Hu-48T 48T
EUR 554
  • Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

DLR-WNT2-Hu-96T 96T
EUR 725
  • Should the Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RDR-WNT2-Hu-48Tests 48 Tests
EUR 589

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RDR-WNT2-Hu-96Tests 96 Tests
EUR 820

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RD-WNT2-Hu-48Tests 48 Tests
EUR 563

Human Wingless Type MMTV Integration Site Family, Member 2 (WNT2) ELISA Kit

RD-WNT2-Hu-96Tests 96 Tests
EUR 783

Polyclonal Wnt2 antibody - C-terminal region

APR00601G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Wnt2 - C-terminal region. This antibody is tested and proven to work in the following applications:

WNT2 Conjugated Antibody

C43192 100ul
EUR 397

WNT2 Conjugated Antibody

C38699 100ul
EUR 397

anti- WNT2 antibody

FNab09517 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: wingless-type MMTV integration site family member 2
  • Uniprot ID: P09544
  • Gene ID: 7472
  • Research Area: Cardiovascular, Developmental biology, Signal Transduction
Description: Antibody raised against WNT2

Anti-WNT2 antibody

PAab09517 100 ug
EUR 386

Anti-Wnt2 Antibody

PB9461 100ug/vial
EUR 294

Anti-WNT2 antibody

STJ28427 100 µl
EUR 277
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.

Anti-WNT2 antibody

STJ115523 100 µl
EUR 277
Description: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene.

Anti-WNT2 antibody

STJ192458 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WNT2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Protein Wnt- 2, WNT2 ELISA KIT

ELI-07463Ra 96 Tests
EUR 928

WNT2 Blocking Peptide

33R-3548 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WNT2 antibody, catalog no. 70R-5380

Wnt2 Blocking Peptide

33R-10810 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Wnt2 antibody, catalog no. 70R-11919

WNT2 Blocking Peptide

DF8067-BP 1mg
EUR 195

WNT2 cloning plasmid

CSB-CL026133HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgaacgcccctctcggtggaatctggctctggctccctctgctcttgacctggctcacccccgaggtcaactcttcatggtggtacatgagagctacaggtggctcctccagggtgatgtgcgataatgtgccaggcctggtgagcagccagcggcagctgtgtcaccgacatc
  • Show more
Description: A cloning plasmid for the WNT2 gene.

Protein Wnt-2 (WNT2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx219361-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx122394-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Wnt-2 (WNT2) Antibody

abx239517-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Protein Wnt-2 (WNT2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wnt Family Member 2 (WNT2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wnt Family Member 2 (WNT2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

WNT2 Rabbit Polyclonal Antibody

Recent Posts


January 2022
