GFRA2 Rabbit Polyclonal Antibody

Contact us: [email protected]

GFRA2 Polyclonal Antibody
ES11190-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GFRA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GFRA2 Rabbit pAb
A2954-100ul	Abclonal	100 ul	EUR 308

GFRA2 Rabbit pAb
A2954-200ul	Abclonal	200 ul	EUR 459

GFRA2 Rabbit pAb
A2954-20ul	Abclonal	20 ul	EUR 183

GFRA2 Rabbit pAb
A2954-50ul	Abclonal	50 ul	EUR 223

GFRA2 Antibody
31206-100ul	SAB	100ul	EUR 252

GFRA2 Antibody
31206-50ul	SAB	50ul	EUR 187

GFRA2 antibody
70R-17467	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GFRA2 antibody

GFRA2 Antibody
1-CSB-PA135383	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 Antibody
1-CSB-PA150222	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 antibody
70R-5332	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2

GFRA2 Antibody
1-CSB-PA009380GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GFRA2 Antibody
1-CSB-PA009380LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GFRA2 Conjugated Antibody
C31206	SAB	100ul	EUR 397

anti- GFRA2 antibody
FNab03438	FN Test	100µg	EUR 585
Immunogen: GDNF family receptor alpha 2 Uniprot ID: O00451 Gene ID: 2675 Research Area: Neuroscience
Description: Antibody raised against GFRA2

anti- GFRA2 antibody
FNab03439	FN Test	100µg	EUR 548.75
Immunogen: GDNF family receptor alpha 2 Uniprot ID: O00451 Gene ID: 2675 Research Area: Neuroscience
Description: Antibody raised against GFRA2

Anti-GFRA2 antibody
PAab03438	Lifescience Market	100 ug	EUR 412

Anti-GFRA2 antibody
PAab03439	Lifescience Market	100 ug	EUR 386

Anti-GFRA2 antibody
STJ23776	St John's Laboratory	100 µl	EUR 277
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GFRA2 antibody
STJ192348	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GFRA2

Anti-GFRA2 Antibody
STJ60017	St John's Laboratory	100 µg	EUR 424

GFRA2 siRNA
20-abx917800	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFRA2 siRNA
20-abx917801	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFRA2 Antibody, HRP conjugated
1-CSB-PA009380LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GFRA2 Antibody, FITC conjugated
1-CSB-PA009380LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GFRA2 Antibody, Biotin conjugated
1-CSB-PA009380LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GFRA2 Blocking Peptide
33R-6924	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332

GFRA2 cloning plasmid
CSB-CL009380HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1395 Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca Show more
Description: A cloning plasmid for the GFRA2 gene.

GFRA2 ELISA KIT|Human
EF009840	Lifescience Market	96 Tests	EUR 689

Mouse GFRA2 shRNA Plasmid
20-abx970520	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GFRA2 shRNA Plasmid
20-abx951784	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-GFRA2 Plasmid
PVT16798	Lifescience Market	2 ug	EUR 325

GFRA2 Recombinant Protein (Human)
RP013135	ABM	100 ug	Ask for price

GFRA2 Recombinant Protein (Rat)
RP202517	ABM	100 ug	Ask for price

GFRA2 Recombinant Protein (Mouse)
RP136337	ABM	100 ug	Ask for price

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx007289	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx412459-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233438-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233439-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx318070	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human GFRA2 PicoKine ELISA Kit
EK2072	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Mouse GFRA2 PicoKine ELISA Kit
EK2073	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rat GFRA2 PicoKine ELISA Kit
EK2074	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Gfra2 ORF Vector (Rat) (pORF)
ORF067507	ABM	1.0 ug DNA	EUR 506

GFRA2 ORF Vector (Human) (pORF)
ORF004379	ABM	1.0 ug DNA	EUR 95

Gfra2 ORF Vector (Mouse) (pORF)
ORF045447	ABM	1.0 ug DNA	EUR 506

GFRA2 ELISA Kit (Human) (OKBB01439)
OKBB01439	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 8p21.3. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Mouse) (OKBB01440)
OKBB01440	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 14; 14 D2. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Rat) (OKBB01441)
OKBB01441	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 15p11. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (HRP)
20-abx315263	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (FITC)
20-abx315264	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (Biotin)
20-abx315265	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-100	Biovision		EUR 718

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-20	Biovision		EUR 267

Gfra2 sgRNA CRISPR Lentivector set (Rat)
K6852601	ABM	3 x 1.0 ug	EUR 339

Gfra2 sgRNA CRISPR Lentivector set (Mouse)
K3373701	ABM	3 x 1.0 ug	EUR 339

GFRA2 sgRNA CRISPR Lentivector set (Human)
K0853101	ABM	3 x 1.0 ug	EUR 339

Recombinant Human GFRA2/GFRα2/GDNFRB Protein
RP00199	Abclonal	5 μg	EUR 136

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human)
4-PAC168Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2)

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), APC
4-PAC168Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with APC.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), Biotinylated
4-PAC168Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with Biotin.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), Cy3
4-PAC168Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with Cy3.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), FITC
4-PAC168Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with FITC.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), HRP
4-PAC168Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with HRP.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), PE
4-PAC168Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with PE.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human, Mouse)
4-PAC168Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2)

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6852602	ABM	1.0 ug DNA	EUR 154

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6852603	ABM	1.0 ug DNA	EUR 154

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6852604	ABM	1.0 ug DNA	EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3373702	ABM	1.0 ug DNA	EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3373703	ABM	1.0 ug DNA	EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3373704	ABM	1.0 ug DNA	EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0853102	ABM	1.0 ug DNA	EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0853103	ABM	1.0 ug DNA	EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0853104	ABM	1.0 ug DNA	EUR 154

GFRA2 Protein Vector (Rat) (pPB-C-His)
PV270026	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Rat) (pPB-N-His)
PV270027	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Rat) (pPM-C-HA)
PV270028	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Rat) (pPM-C-His)
PV270029	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Mouse) (pPB-C-His)
PV181786	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Mouse) (pPB-N-His)
PV181787	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Mouse) (pPM-C-HA)
PV181788	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Mouse) (pPM-C-His)
PV181789	ABM	500 ng	EUR 603

GFRA2 Protein Vector (Human) (pPB-C-His)
PV017513	ABM	500 ng	EUR 329

GFRA2 Protein Vector (Human) (pPB-N-His)
PV017514	ABM	500 ng	EUR 329

GFRA2 Protein Vector (Human) (pPM-C-HA)
PV017515	ABM	500 ng	EUR 329

GFRA2 Protein Vector (Human) (pPM-C-His)
PV017516	ABM	500 ng	EUR 329

Gfra2 3'UTR Luciferase Stable Cell Line
TU107024	ABM	1.0 ml	Ask for price

Gfra2 3'UTR GFP Stable Cell Line
TU157024	ABM	1.0 ml	Ask for price

Gfra2 3'UTR Luciferase Stable Cell Line
TU205057	ABM	1.0 ml	Ask for price

Gfra2 3'UTR GFP Stable Cell Line
TU255057	ABM	1.0 ml	Ask for price

GFRA2 3'UTR GFP Stable Cell Line
TU058747	ABM	1.0 ml	EUR 1521

GFRA2 3'UTR Luciferase Stable Cell Line
TU008747	ABM	1.0 ml	EUR 1521

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), APC-Cy7
4-PAC168Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GFRa2 (Thr117~Pro314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with APC-Cy7.

GFRA2 Rabbit Polyclonal Antibody