Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


GFRA2 Rabbit Polyclonal Antibody

GFRA2 Rabbit Polyclonal Antibody

Contact us: [email protected]

GFRA2 Polyclonal Antibody

ES11190-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GFRA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GFRA2 Rabbit pAb

A2954-100ul 100 ul
EUR 308

GFRA2 Rabbit pAb

A2954-200ul 200 ul
EUR 459

GFRA2 Rabbit pAb

A2954-20ul 20 ul
EUR 183

GFRA2 Rabbit pAb

A2954-50ul 50 ul
EUR 223

GFRA2 Antibody

31206-100ul 100ul
EUR 252

GFRA2 Antibody

31206-50ul 50ul
EUR 187

GFRA2 antibody

70R-17467 50 ul
EUR 435
Description: Rabbit polyclonal GFRA2 antibody

GFRA2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 antibody

70R-5332 50 ug
EUR 467
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2

GFRA2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GFRA2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GFRA2 Conjugated Antibody

C31206 100ul
EUR 397

anti- GFRA2 antibody

FNab03438 100µg
EUR 585
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2

anti- GFRA2 antibody

FNab03439 100µg
EUR 548.75
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2

Anti-GFRA2 antibody

PAab03438 100 ug
EUR 412

Anti-GFRA2 antibody

PAab03439 100 ug
EUR 386

Anti-GFRA2 antibody

STJ23776 100 µl
EUR 277
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GFRA2 antibody

STJ192348 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GFRA2

Anti-GFRA2 Antibody

STJ60017 100 µg
EUR 424


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GFRA2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GFRA2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GFRA2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GFRA2 Blocking Peptide

33R-6924 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332

GFRA2 cloning plasmid

CSB-CL009380HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca
  • Show more
Description: A cloning plasmid for the GFRA2 gene.


EF009840 96 Tests
EUR 689

Mouse GFRA2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GFRA2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16798 2 ug
EUR 325

GFRA2 Recombinant Protein (Human)

RP013135 100 ug Ask for price

GFRA2 Recombinant Protein (Rat)

RP202517 100 ug Ask for price

GFRA2 Recombinant Protein (Mouse)

RP136337 100 ug Ask for price

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx028008-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx028008-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx412459-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx233438-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

abx233439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human GFRA2 PicoKine ELISA Kit

EK2072 96 wells
EUR 425
Description: For quantitative detection of human GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Mouse GFRA2 PicoKine ELISA Kit

EK2073 96 wells
EUR 425
Description: For quantitative detection of mouse GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rat GFRA2 PicoKine ELISA Kit

EK2074 96 wells
EUR 425
Description: For quantitative detection of rat GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Gfra2 ORF Vector (Rat) (pORF)

ORF067507 1.0 ug DNA
EUR 506

GFRA2 ORF Vector (Human) (pORF)

ORF004379 1.0 ug DNA
EUR 95

Gfra2 ORF Vector (Mouse) (pORF)

ORF045447 1.0 ug DNA
EUR 506

GFRA2 ELISA Kit (Human) (OKBB01439)

OKBB01439 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 8p21.3. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Mouse) (OKBB01440)

OKBB01440 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 14; 14 D2. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Rat) (OKBB01441)

OKBB01441 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 15p11. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human CellExp? GFRA2 /GDNFRB, human recombinant

EUR 718

Human CellExp? GFRA2 /GDNFRB, human recombinant

EUR 267

Gfra2 sgRNA CRISPR Lentivector set (Rat)

K6852601 3 x 1.0 ug
EUR 339

Gfra2 sgRNA CRISPR Lentivector set (Mouse)

K3373701 3 x 1.0 ug
EUR 339

GFRA2 sgRNA CRISPR Lentivector set (Human)

K0853101 3 x 1.0 ug
EUR 339

Recombinant Human GFRA2/GFRα2/GDNFRB Protein

RP00199 5 μg
EUR 136

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2)

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with APC.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with Biotin.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with Cy3.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with FITC.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with HRP.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with PE.

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2)

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6852602 1.0 ug DNA
EUR 154

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6852603 1.0 ug DNA
EUR 154

Gfra2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6852604 1.0 ug DNA
EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3373702 1.0 ug DNA
EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3373703 1.0 ug DNA
EUR 154

Gfra2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3373704 1.0 ug DNA
EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0853102 1.0 ug DNA
EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0853103 1.0 ug DNA
EUR 154

GFRA2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0853104 1.0 ug DNA
EUR 154

GFRA2 Protein Vector (Rat) (pPB-C-His)

PV270026 500 ng
EUR 603

GFRA2 Protein Vector (Rat) (pPB-N-His)

PV270027 500 ng
EUR 603

GFRA2 Protein Vector (Rat) (pPM-C-HA)

PV270028 500 ng
EUR 603

GFRA2 Protein Vector (Rat) (pPM-C-His)

PV270029 500 ng
EUR 603

GFRA2 Protein Vector (Mouse) (pPB-C-His)

PV181786 500 ng
EUR 603

GFRA2 Protein Vector (Mouse) (pPB-N-His)

PV181787 500 ng
EUR 603

GFRA2 Protein Vector (Mouse) (pPM-C-HA)

PV181788 500 ng
EUR 603

GFRA2 Protein Vector (Mouse) (pPM-C-His)

PV181789 500 ng
EUR 603

GFRA2 Protein Vector (Human) (pPB-C-His)

PV017513 500 ng
EUR 329

GFRA2 Protein Vector (Human) (pPB-N-His)

PV017514 500 ng
EUR 329

GFRA2 Protein Vector (Human) (pPM-C-HA)

PV017515 500 ng
EUR 329

GFRA2 Protein Vector (Human) (pPM-C-His)

PV017516 500 ng
EUR 329

Gfra2 3'UTR Luciferase Stable Cell Line

TU107024 1.0 ml Ask for price

Gfra2 3'UTR GFP Stable Cell Line

TU157024 1.0 ml Ask for price

Gfra2 3'UTR Luciferase Stable Cell Line

TU205057 1.0 ml Ask for price

Gfra2 3'UTR GFP Stable Cell Line

TU255057 1.0 ml Ask for price

GFRA2 3'UTR GFP Stable Cell Line

TU058747 1.0 ml
EUR 1521

GFRA2 3'UTR Luciferase Stable Cell Line

TU008747 1.0 ml
EUR 1521

Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GFRa2 (Thr117~Pro314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glial Cell Line Derived Neurotrophic Factor Receptor Alpha 2 (GFRa2). This antibody is labeled with APC-Cy7.

GFRA2 Rabbit Polyclonal Antibody

Recent Posts


January 2022
