Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


FABP6 Rabbit Polyclonal Antibody

FABP6 Rabbit Polyclonal Antibody

Contact us: [email protected]

FABP6 Polyclonal Antibody

ES11334-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FABP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FABP6 Rabbit pAb

A13491-100ul 100 ul
EUR 308

FABP6 Rabbit pAb

A13491-200ul 200 ul
EUR 459

FABP6 Rabbit pAb

A13491-20ul 20 ul
EUR 183

FABP6 Rabbit pAb

A13491-50ul 50 ul
EUR 223

FABP6 Rabbit pAb

A6906-100ul 100 ul
EUR 308

FABP6 Rabbit pAb

A6906-200ul 200 ul
EUR 459

FABP6 Rabbit pAb

A6906-20ul 20 ul
EUR 183

FABP6 Rabbit pAb

A6906-50ul 50 ul
EUR 223

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Hu-48T 48T
EUR 479
  • Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Hu-96T 96T
EUR 621
  • Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Mu-48T 48T
EUR 489
  • Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

DLR-FABP6-Mu-96T 96T
EUR 635
  • Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Hu-48Tests 48 Tests
EUR 500

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Hu-96Tests 96 Tests
EUR 692

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Mu-48Tests 48 Tests
EUR 511

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RDR-FABP6-Mu-96Tests 96 Tests
EUR 709

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Hu-48Tests 48 Tests
EUR 478

Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Hu-96Tests 96 Tests
EUR 662

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Mu-48Tests 48 Tests
EUR 489

Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit

RD-FABP6-Mu-96Tests 96 Tests
EUR 677

FABP6 Antibody

36456-100ul 100ul
EUR 252

FABP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FABP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FABP6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FABP6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FABP6 Antibody

ABC6906 100 ug
EUR 386

Rabbit FABP6 ELISA Kit

ERTF0046 96Tests
EUR 521

Rabbit Gastrotropin, FABP6 ELISA KIT

ELI-07189Ra 96 Tests
EUR 928

Rabbit Gastrotropin (FABP6) ELISA Kit

abx363471-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Gastrotropin(FABP6) ELISA kit

E04G0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FABP6 Conjugated Antibody

C36456 100ul
EUR 397

Anti-FABP6 Antibody

PA2158 100ug/vial
EUR 334

Anti-FABP6 antibody

STJ28986 100 µl
EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody

STJ115452 100 µl
EUR 277
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene.

Anti-FABP6 antibody

STJ192492 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FABP6

Polyclonal I-BABP / FABP6 Antibody (aa1-142)

APR07907G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human I-BABP / FABP6 (aa1-142). This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11689 50 ug
EUR 363
Description: Mouse polyclonal to FABP6


YF-PA11690 100 ug
EUR 403
Description: Rabbit polyclonal to FABP6

Human Gastrotropin (FABP6)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gastrotropin(FABP6) expressed in E.coli

FABP6 cloning plasmid

CSB-CL007955HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacac
  • Show more
Description: A cloning plasmid for the FABP6 gene.

Recombinant Human FABP6

P0126 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P51161
Description: Recombinant Human protein for FABP6

Anti-FABP6 (4A4)

YF-MA12949 100 ug
EUR 363
Description: Mouse monoclonal to FABP6

pBluescriptR-FABP6 Plasmid

PVT17004 2 ug
EUR 325

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig)

  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6)

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6)

FABP6 protein (isoform 2)

30R-1189 100 ug
EUR 397
Description: Purified recombinant Human FABP6 protein (isoform 2)


EHF0046 96Tests
EUR 521


ELA-E2247h 96 Tests
EUR 824


EGTF0046 96Tests
EUR 521

Bovine FABP6 ELISA Kit

EBF0046 96Tests
EUR 521

Canine FABP6 ELISA Kit

ECF0046 96Tests
EUR 521

Chicken FABP6 ELISA Kit

ECKF0046 96Tests
EUR 521

Anserini FABP6 ELISA Kit

EAF0046 96Tests
EUR 521


EF006255 96 Tests
EUR 689

Rat FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FABP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMF0046 96Tests
EUR 521


ERF0046 96Tests
EUR 521


ESF0046 96Tests
EUR 521

Monkey FABP6 ELISA Kit

EMKF0046 96Tests
EUR 521

Porcine FABP6 ELISA Kit

EPF0046 96Tests
EUR 521

FABP6 Recombinant Protein (Human)

RP011167 100 ug Ask for price

FABP6 Recombinant Protein (Rat)

RP200240 100 ug Ask for price

FABP6 Recombinant Protein (Mouse)

RP132698 100 ug Ask for price

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with FITC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with HRP.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Met1~Ala128)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with PE.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with APC.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Biotin.

Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FABP6 (Glu10~Ala128)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6). This antibody is labeled with Cy3.

FABP6 Rabbit Polyclonal Antibody

Recent Posts


January 2022
