CNDP1 Rabbit Polyclonal Antibody

Contact us: [email protected]

CNDP1 Polyclonal Antibody
ABP58202-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410 Applications tips:
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410

CNDP1 Polyclonal Antibody
ES11310-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNDP1 Polyclonal Antibody
ES11310-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

CNDP1 Rabbit pAb
A7485-100ul	Abclonal	100 ul	EUR 308

CNDP1 Rabbit pAb
A7485-200ul	Abclonal	200 ul	EUR 459

CNDP1 Rabbit pAb
A7485-20ul	Abclonal	20 ul	EUR 183

CNDP1 Rabbit pAb
A7485-50ul	Abclonal	50 ul	EUR 223

Polyclonal CNDP1 Antibody (Center)
APR04238G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CNDP1 Antibody (Center)
APR04637G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

CNDP1 antibody
70R-10125	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CNDP1 antibody

CNDP1 Antibody
36359-100ul	SAB	100ul	EUR 252

CNDP1 antibody
10R-3701	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CNDP1 antibody

CNDP1 Antibody
1-CSB-PA836242ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CNDP1 Antibody
1-CSB-PA836242ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CNDP1 Antibody
1-CSB-PA439589	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal CNDP1 Antibody (C-term)
APR06148G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications:

CNDP1 Conjugated Antibody
C36359	SAB	100ul	EUR 397

anti- CNDP1 antibody
FNab01794	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IF: 1:20-1:200 Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family) Uniprot ID: Q96KN2 Gene ID: 84735 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CNDP1

Anti-CNDP1 antibody
PAab01794	Lifescience Market	100 ug	EUR 355

Anti-CNDP1 antibody
STJ29621	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.

Anti-CNDP1 antibody
STJ192468	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CNDP1

Cndp1/ Rat Cndp1 ELISA Kit
ELI-03928r	Lifescience Market	96 Tests	EUR 886

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human)
4-PAF388Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1)

CNDP1 protein
80R-4374	Fitzgerald	50 ug	EUR 457
Description: Purified Recombinant CNDP1 protein (His tagged)

CNDP1 siRNA
20-abx901140	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNDP1 siRNA
20-abx912223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNDP1 siRNA
20-abx912224	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CNDP1
YF-PA21472	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CNDP1

anti-CNDP1
YF-PA21473	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to CNDP1

anti-CNDP1
YF-PA21474	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CNDP1

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC
4-PAF388Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated
4-PAF388Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3
4-PAF388Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC
4-PAF388Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP
4-PAF388Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE
4-PAF388Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE.

CNDP1 Blocking Peptide
33R-3591	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125

CNDP1 cloning plasmid
CSB-CL836242HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 933 Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid
CSB-CL836242HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1527 Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid
CSB-CL836242HU3-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1524 Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca Show more
Description: A cloning plasmid for the CNDP1 gene.

Carnosine Dipeptidase 1 (CNDP1) Antibody
20-abx128272	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carnosine Dipeptidase 1 (CNDP1) Antibody
20-abx171590	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC-Cy7
4-PAF388Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC-Cy7.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit
E04B0887-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
20-abx006984	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx145510-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx145513-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx029702-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx029702-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx034256-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
abx034256-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody
20-abx242083	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CNDP1 Rabbit Polyclonal Antibody