Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

CNDP1 Rabbit Polyclonal Antibody

CNDP1 Rabbit Polyclonal Antibody

Contact us: [email protected]

CNDP1 Polyclonal Antibody

ABP58202-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of CNDP1 from Human, Mouse, Rat. This CNDP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNDP1 protein at amino acid sequence of 330-410

CNDP1 Polyclonal Antibody

ES11310-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNDP1 Polyclonal Antibody

ES11310-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-48T 48T
EUR 517
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-96T 96T
EUR 673
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-48Tests 48 Tests
EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-96Tests 96 Tests
EUR 756

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-48Tests 48 Tests
EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-96Tests 96 Tests
EUR 723

CNDP1 Rabbit pAb

A7485-100ul 100 ul
EUR 308

CNDP1 Rabbit pAb

A7485-200ul 200 ul
EUR 459

CNDP1 Rabbit pAb

A7485-20ul 20 ul
EUR 183

CNDP1 Rabbit pAb

A7485-50ul 50 ul
EUR 223

Polyclonal CNDP1 Antibody (Center)

APR04238G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CNDP1 Antibody (Center)

APR04637G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

CNDP1 antibody

70R-10125 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CNDP1 antibody

CNDP1 Antibody

36359-100ul 100ul
EUR 252

CNDP1 antibody

10R-3701 100 ul
EUR 691
Description: Mouse monoclonal CNDP1 antibody

CNDP1 Antibody

1-CSB-PA836242ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CNDP1 Antibody

1-CSB-PA836242ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CNDP1 Antibody

1-CSB-PA439589
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal CNDP1 Antibody (C-term)

APR06148G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications:

CNDP1 Conjugated Antibody

C36359 100ul
EUR 397

anti- CNDP1 antibody

FNab01794 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:20-1:200
  • Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family)
  • Uniprot ID: Q96KN2
  • Gene ID: 84735
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CNDP1

Anti-CNDP1 antibody

PAab01794 100 ug
EUR 355

Anti-CNDP1 antibody

STJ29621 100 µl
EUR 277
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.

Anti-CNDP1 antibody

STJ192468 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNDP1

Cndp1/ Rat Cndp1 ELISA Kit

ELI-03928r 96 Tests
EUR 886

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human)

4-PAF388Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1)

CNDP1 protein

80R-4374 50 ug
EUR 457
Description: Purified Recombinant CNDP1 protein (His tagged)

CNDP1 siRNA

20-abx901140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNDP1 siRNA

20-abx912223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNDP1 siRNA

20-abx912224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CNDP1

YF-PA21472 50 ug
EUR 363
Description: Mouse polyclonal to CNDP1

anti-CNDP1

YF-PA21473 100 ul
EUR 403
Description: Rabbit polyclonal to CNDP1

anti-CNDP1

YF-PA21474 100 ug
EUR 403
Description: Rabbit polyclonal to CNDP1

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC

4-PAF388Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated

4-PAF388Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3

4-PAF388Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC

4-PAF388Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP

4-PAF388Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE

4-PAF388Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE.

CNDP1 Blocking Peptide

33R-3591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125

CNDP1 cloning plasmid

CSB-CL836242HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid

CSB-CL836242HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1527
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid

CSB-CL836242HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

Carnosine Dipeptidase 1 (CNDP1) Antibody

20-abx128272
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carnosine Dipeptidase 1 (CNDP1) Antibody

20-abx171590
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC-Cy7

4-PAF388Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC-Cy7.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit

E04B0887-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit

E04B0887-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β Ala His dipeptidase(CNDP1) ELISA kit

E04B0887-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

20-abx006984
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx145510-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx145513-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx029702-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx029702-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx034256-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

abx034256-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta-Ala-His Dipeptidase (CNDP1) Antibody

20-abx242083
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CNDP1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages