CALCA Rabbit Polyclonal Antibody

Contact us: [email protected]

CALCA Polyclonal Antibody
ABP57963-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120 Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody
ABP57963-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120 Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody
ABP57963-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120 Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody
ES11390-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CALCA Polyclonal Antibody
ES11390-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CALCA/CALCA Antibody
1-CSB-PA060153	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALCA/CALCA. Recognizes CALCA/CALCA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

CALCA / CALCA Antibody
20-abx322895	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

CALCA Rabbit pAb
A13957-100ul	Abclonal	100 ul	EUR 308

CALCA Rabbit pAb
A13957-200ul	Abclonal	200 ul	EUR 459

CALCA Rabbit pAb
A13957-20ul	Abclonal	20 ul	EUR 183

CALCA Rabbit pAb
A13957-50ul	Abclonal	50 ul	EUR 223

CALCA Rabbit pAb
A11804-100ul	Abclonal	100 ul	EUR 308

CALCA Rabbit pAb
A11804-200ul	Abclonal	200 ul	EUR 459

CALCA Rabbit pAb
A11804-20ul	Abclonal	20 ul	Ask for price

CALCA Rabbit pAb
A11804-50ul	Abclonal	50 ul	Ask for price

Polyclonal CALCA Antibody (Center)
APR11539G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA (Center). This antibody is tested and proven to work in the following applications:

CALCA/CALCB Polyclonal Conjugated Antibody
C31944	SAB	100ul	EUR 397

CALCA Polyclonal Antibody, Biotin Conjugated
A52254	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CALCA Polyclonal Antibody, FITC Conjugated
A52255	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CALCA Polyclonal Antibody, HRP Conjugated
A52256	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CALCA Antibody
32898-100ul	SAB	100ul	EUR 252

CALCA antibody
10R-8356	Fitzgerald	100 ul	EUR 392
Description: Mouse monoclonal CALCA antibody

CALCA Antibody
1-CSB-PA004434HA01DO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CALCA Antibody
1-CSB-PA095703	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody
1-CSB-PA12134A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CALCA Antibody
1-CSB-PA594619	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CALCA Antibody
1-CSB-PA680635	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody
DF7386	Affbiotech	200ul	EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody
DF7785	Affbiotech	200ul	EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody
1-CSB-PA182905	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CALCA Antibody
1-CSB-PA216407	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

CALCA Antibody
ABD7386	Lifescience Market	100 ug	EUR 438

CALCA Antibody
ABD7785	Lifescience Market	100 ug	EUR 438

CALCA Antibody
ABD7786	Lifescience Market	100 ug	EUR 438

CALCA Antibody
ABD7985	Lifescience Market	100 ug	EUR 438

Polyclonal CALCA/CT Antibody (C-term)
APR04041G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA/CT (C-term). This antibody is tested and proven to work in the following applications:

Rabbit Calcitonin (CALCA) ELISA Kit
abx256998-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

CALCA/CALCB antibody
31944-100ul	SAB	100ul	EUR 252

CALCA/CALCB antibody
31944-50ul	SAB	50ul	EUR 187

Calcitonin (CALCA) Antibody
20-abx007886	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx022516-20ul	Abbexa	20 ul	EUR 328
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx025389-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx025390-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx025390-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx026097-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx026097-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
20-abx004242	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
20-abx100229	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Calcitonin (CALCA) Antibody
20-abx131752	Abbexa	EUR 342.00 EUR 899.00 EUR 467.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody
20-abx132191	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody
20-abx132280	Abbexa	EUR 328.00 EUR 843.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody
abx146688-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
20-abx146798	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx148151-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx028427-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody
abx028427-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

CALCA Conjugated Antibody
C32898	SAB	100ul	EUR 397

Anti-CALCA antibody
STJ27531	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody
STJ113383	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody
STJ115892	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA Antibody
STJ500585	St John's Laboratory	100 µg	EUR 476

Anti-CALCA Antibody
STJ500586	St John's Laboratory	100 µg	EUR 476

Anti-CALCA antibody
STJ192548	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CALCA

Calca/ Rat Calca ELISA Kit
ELI-25243r	Lifescience Market	96 Tests	EUR 886

CALCA Antibody, HRP conjugated
1-CSB-PA004434HB01DO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated
1-CSB-PA004434HC01DO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated
1-CSB-PA004434HD01DO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALCA Antibody, HRP conjugated
1-CSB-PA12134B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated
1-CSB-PA12134C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated
1-CSB-PA12134D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Calcitonin/Calca Antibody
A02352	BosterBio	100ug/vial	EUR 334

Anti-Calcitonin/CALCA Antibody
PB9936	BosterBio	100ug/vial	EUR 334

Anti-Calcitonin/CALCA Antibody
PB9937	BosterBio	100ug/vial	EUR 334

Anti-CALCA Antibody (Biotin)
STJ500587	St John's Laboratory	100 µg	EUR 586

Anti-CALCA Antibody (FITC)
STJ500588	St John's Laboratory	100 µg	EUR 586

Anti-CALCA Antibody (Biotin)
STJ500589	St John's Laboratory	100 µg	EUR 586

Anti-CALCA Antibody (FITC)
STJ500590	St John's Laboratory	100 µg	EUR 586

Dog Calcitonin (CALCA)
1-CSB-EP004434DO	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 19.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Calcitonin(CALCA),partial expressed in E.coli

CALCA Blocking Peptide
DF7386-BP	Affbiotech	1mg	EUR 195

CALCA Blocking Peptide
DF7785-BP	Affbiotech	1mg	EUR 195

CALCA cloning plasmid
CSB-CL004434HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 426 Sequence: atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgt Show more
Description: A cloning plasmid for the CALCA gene.

Monoclonal CALCA/CT Antibody, Clone: 406CT21.4.3
AMM02399G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human CALCA/CT. The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E

Human CALCA ELISA Kit
ELA-E1213h	Lifescience Market	96 Tests	EUR 824

CALCA ELISA KIT|Human
EF004510	Lifescience Market	96 Tests	EUR 689

Rat CALCA shRNA Plasmid
20-abx984395	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CALCA shRNA Plasmid
20-abx984396	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Katacalcin (CALCA) Protein
abx670053-01mg	Abbexa	0.1 mg	EUR 286
Shipped within 1 week.

Mouse CALCA shRNA Plasmid
20-abx969440	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CALCA shRNA Plasmid
20-abx969441	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CALCA shRNA Plasmid
20-abx950557	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CALCA shRNA Plasmid
20-abx950558	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine CALCA ELISA KIT
ELI-50378d	Lifescience Market	96 Tests	EUR 928

CALCA Recombinant Protein (Human)
RP005446	ABM	100 ug	Ask for price

CALCA Recombinant Protein (Rat)
RP192887	ABM	100 ug	Ask for price

CALCA Recombinant Protein (Rat)
RP192890	ABM	100 ug	Ask for price

CALCA Recombinant Protein (Rat)
RP192893	ABM	100 ug	Ask for price

CALCA Recombinant Protein (Mouse)
RP120794	ABM	100 ug	Ask for price

CALCA Recombinant Protein (Mouse)
RP120797	ABM	100 ug	Ask for price

Mouse CALCA ELISA Kit
STJ150014	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Mouse serum, plasma and other biological fluids

CALCA Rabbit Polyclonal Antibody