Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

CALCA Rabbit Polyclonal Antibody

CALCA Rabbit Polyclonal Antibody

Contact us: [email protected]

CALCA Polyclonal Antibody
ABP57963-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ABP57963-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ABP57963-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
CALCA Polyclonal Antibody
ES11390-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CALCA Polyclonal Antibody
ES11390-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CALCA/CALCA Antibody
1-CSB-PA060153
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALCA/CALCA. Recognizes CALCA/CALCA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
CALCA / CALCA Antibody
20-abx322895
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
CALCA Rabbit pAb
A13957-100ul 100 ul
EUR 308
CALCA Rabbit pAb
A13957-200ul 200 ul
EUR 459
CALCA Rabbit pAb
A13957-20ul 20 ul
EUR 183
CALCA Rabbit pAb
A13957-50ul 50 ul
EUR 223
CALCA Rabbit pAb
A11804-100ul 100 ul
EUR 308
CALCA Rabbit pAb
A11804-200ul 200 ul
EUR 459
CALCA Rabbit pAb
A11804-20ul 20 ul Ask for price
CALCA Rabbit pAb
A11804-50ul 50 ul Ask for price
Polyclonal CALCA Antibody (Center)
APR11539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA (Center). This antibody is tested and proven to work in the following applications:
CALCA/CALCB Polyclonal Conjugated Antibody
C31944 100ul
EUR 397
CALCA Polyclonal Antibody, Biotin Conjugated
A52254 100 µg
EUR 570.55
Description: kits suitable for this type of research
CALCA Polyclonal Antibody, FITC Conjugated
A52255 100 µg
EUR 570.55
Description: fast delivery possible
CALCA Polyclonal Antibody, HRP Conjugated
A52256 100 µg
EUR 570.55
Description: reagents widely cited
CALCA Antibody
32898-100ul 100ul
EUR 252
CALCA antibody
10R-8356 100 ul
EUR 392
Description: Mouse monoclonal CALCA antibody
CALCA Antibody
1-CSB-PA004434HA01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
CALCA Antibody
1-CSB-PA095703
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CALCA Antibody
1-CSB-PA12134A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA
CALCA Antibody
1-CSB-PA594619
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
CALCA Antibody
1-CSB-PA680635
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
CALCA Antibody
DF7386 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.
CALCA Antibody
DF7785 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.
CALCA Antibody
1-CSB-PA182905
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
CALCA Antibody
1-CSB-PA216407
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
CALCA Antibody
ABD7386 100 ug
EUR 438
CALCA Antibody
ABD7785 100 ug
EUR 438
CALCA Antibody
ABD7786 100 ug
EUR 438
CALCA Antibody
ABD7985 100 ug
EUR 438
Polyclonal CALCA/CT Antibody (C-term)
APR04041G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA/CT (C-term). This antibody is tested and proven to work in the following applications:
Rabbit Calcitonin (CALCA) ELISA Kit
abx256998-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
CALCA/CALCB antibody
31944-100ul 100ul
EUR 252
CALCA/CALCB antibody
31944-50ul 50ul
EUR 187
Calcitonin (CALCA) Antibody
20-abx007886
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx022516-20ul 20 ul
EUR 328
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025389-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx025390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx026097-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx026097-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx004242
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx100229
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Calcitonin (CALCA) Antibody
20-abx131752
  • EUR 342.00
  • EUR 899.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
20-abx132191
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
20-abx132280
  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcitonin (CALCA) Antibody
abx146688-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
20-abx146798
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx148151-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx028427-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Calcitonin (CALCA) Antibody
abx028427-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CALCA Conjugated Antibody
C32898 100ul
EUR 397
Anti-CALCA antibody
STJ27531 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA antibody
STJ113383 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA antibody
STJ115892 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-CALCA Antibody
STJ500585 100 µg
EUR 476
Anti-CALCA Antibody
STJ500586 100 µg
EUR 476
Anti-CALCA antibody
STJ192548 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CALCA
Calca/ Rat Calca ELISA Kit
ELI-25243r 96 Tests
EUR 886
CALCA Antibody, HRP conjugated
1-CSB-PA004434HB01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA
CALCA Antibody, FITC conjugated
1-CSB-PA004434HC01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA
CALCA Antibody, Biotin conjugated
1-CSB-PA004434HD01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA
CALCA Antibody, HRP conjugated
1-CSB-PA12134B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CALCA Antibody, FITC conjugated
1-CSB-PA12134C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CALCA Antibody, Biotin conjugated
1-CSB-PA12134D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-Calcitonin/Calca Antibody
A02352 100ug/vial
EUR 334
Anti-Calcitonin/CALCA Antibody
PB9936 100ug/vial
EUR 334
Anti-Calcitonin/CALCA Antibody
PB9937 100ug/vial
EUR 334
Anti-CALCA Antibody (Biotin)
STJ500587 100 µg
EUR 586
Anti-CALCA Antibody (FITC)
STJ500588 100 µg
EUR 586
Anti-CALCA Antibody (Biotin)
STJ500589 100 µg
EUR 586
Anti-CALCA Antibody (FITC)
STJ500590 100 µg
EUR 586
Dog Calcitonin (CALCA)
1-CSB-EP004434DO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Calcitonin(CALCA),partial expressed in E.coli
CALCA Blocking Peptide
DF7386-BP 1mg
EUR 195
CALCA Blocking Peptide
DF7785-BP 1mg
EUR 195
CALCA cloning plasmid
CSB-CL004434HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgt
  • Show more
Description: A cloning plasmid for the CALCA gene.
Monoclonal CALCA/CT Antibody, Clone: 406CT21.4.3
AMM02399G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CALCA/CT. The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E
Human CALCA ELISA Kit
ELA-E1213h 96 Tests
EUR 824
CALCA ELISA KIT|Human
EF004510 96 Tests
EUR 689
Rat CALCA shRNA Plasmid
20-abx984395
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat CALCA shRNA Plasmid
20-abx984396
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Katacalcin (CALCA) Protein
abx670053-01mg 0.1 mg
EUR 286
  • Shipped within 1 week.
Mouse CALCA shRNA Plasmid
20-abx969440
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CALCA shRNA Plasmid
20-abx969441
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CALCA shRNA Plasmid
20-abx950557
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CALCA shRNA Plasmid
20-abx950558
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine CALCA ELISA KIT
ELI-50378d 96 Tests
EUR 928
CALCA Recombinant Protein (Human)
RP005446 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192887 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192890 100 ug Ask for price
CALCA Recombinant Protein (Rat)
RP192893 100 ug Ask for price
CALCA Recombinant Protein (Mouse)
RP120794 100 ug Ask for price
CALCA Recombinant Protein (Mouse)
RP120797 100 ug Ask for price
Mouse CALCA ELISA Kit
STJ150014 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Mouse serum, plasma and other biological fluids

CALCA Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages