ATL1 Rabbit Polyclonal Antibody

Contact us: [email protected]

ATL1 Polyclonal Antibody
ABP57840-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ATL1 protein Applications tips:
Description: A polyclonal antibody for detection of ATL1 from Human, Mouse. This ATL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATL1 protein

ATL1 Polyclonal Antibody
ES11143-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATL1 Polyclonal Antibody
ES11143-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATL1 Rabbit pAb
A5302-100ul	Abclonal	100 ul	EUR 308

ATL1 Rabbit pAb
A5302-200ul	Abclonal	200 ul	EUR 459

ATL1 Rabbit pAb
A5302-20ul	Abclonal	20 ul	EUR 183

ATL1 Rabbit pAb
A5302-50ul	Abclonal	50 ul	EUR 223

ATL1 antibody
70R-15892	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ATL1 antibody

ATL1 Antibody
32756-100ul	SAB	100ul	EUR 252

ATL1 Antibody
1-CSB-PA002300GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ATL1. Recognizes ATL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ATL1 Antibody
1-CSB-PA855500LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATL1. Recognizes ATL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATL1 Antibody
DF7262	Affbiotech	200ul	EUR 304
Description: ATL1 Antibody detects endogenous levels of total ATL1.

ATL1 Antibody
ABD7262	Lifescience Market	100 ug	EUR 438

Polyclonal ATL1 Antibody (C-term)
APR14093G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATL1 (C-term). This antibody is tested and proven to work in the following applications:

ATL1 Conjugated Antibody
C32756	SAB	100ul	EUR 397

Anti-ATL1 antibody
PAab00682	Lifescience Market	100 ug	EUR 355

Anti-ATL1 antibody
STJ27255	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a GTPase and a Golgi body transmembrane protein. The encoded protein can form a homotetramer and has been shown to interact with spastin and with mitogen-activated protein kinase kinase kinase kinase 4. This protein may be involved in axonal maintenance as evidenced by the fact that defects in this gene are a cause of spastic paraplegia type 3. Three transcript variants encoding two different isoforms have been found for this gene.

Anti-ATL1 antibody
STJ192301	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ATL1

Atl1/ Rat Atl1 ELISA Kit
ELI-12017r	Lifescience Market	96 Tests	EUR 886

ATL1 siRNA
20-abx900506	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATL1 siRNA
20-abx908480	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATL1 siRNA
20-abx908481	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rabbit Atlastin 1(ATL1) ELISA kit
E04A1754-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Atlastin 1(ATL1) ELISA kit
E04A1754-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Atlastin 1(ATL1) ELISA kit
E04A1754-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATL1 Antibody, HRP conjugated
1-CSB-PA855500LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATL1. Recognizes ATL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATL1 Antibody, FITC conjugated
1-CSB-PA855500LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATL1. Recognizes ATL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATL1 Antibody, Biotin conjugated
1-CSB-PA855500LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATL1. Recognizes ATL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Atlastin 1 (ATL1) Antibody
20-abx004052	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
20-abx111115	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
abx036354-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
abx038381-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
20-abx141723	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
abx029073-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
abx029073-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
20-abx334378	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody
abx230682-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

ATL1 Blocking Peptide
DF7262-BP	Affbiotech	1mg	EUR 195

ATL1 cloning plasmid
CSB-CL855500HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1677 Sequence: atggccaagaaccgcagggacagaaacagttggggtggattttcggaaaagacatatgaatggagctcagaagaggaggagccagtgaaaaaggcaggaccagtccaagtcctcattgtcaaagatgagcattcctttgagttagatgaaactgcattaaatcggatccttctct Show more
Description: A cloning plasmid for the ATL1 gene.

pCMV-SPORT6-ATL1
PVT12903	Lifescience Market	2 ug	EUR 391

Atlastin 1 (ATL1) Antibody (HRP)
20-abx334737	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody (FITC)
20-abx334738	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Atlastin 1 (ATL1) Antibody (Biotin)
20-abx334739	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ATL1 ELISA KIT|Human
EF007970	Lifescience Market	96 Tests	EUR 689

Rat ATL1 shRNA Plasmid
20-abx990439	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ATL1 shRNA Plasmid
20-abx978047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ATL1 shRNA Plasmid
20-abx959486	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ATL1 Recombinant Protein (Human)
RP002233	ABM	100 ug	Ask for price

ATL1 Recombinant Protein (Mouse)
RP117806	ABM	100 ug	Ask for price

ATL1 Recombinant Protein (Rat)
RP191345	ABM	100 ug	Ask for price

Atl1 ORF Vector (Rat) (pORF)
ORF063783	ABM	1.0 ug DNA	EUR 506

ATL1 ORF Vector (Human) (pORF)
ORF000745	ABM	1.0 ug DNA	EUR 95

Atl1 ORF Vector (Mouse) (pORF)
ORF039270	ABM	1.0 ug DNA	EUR 506

Human Atlastin 1(ATL1) ELISA kit
E01A1754-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Atlastin 1(ATL1) ELISA kit
E01A1754-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Atlastin 1(ATL1) ELISA kit
E01A1754-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Atlastin 1(ATL1) ELISA kit
E02A1754-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Atlastin 1(ATL1) ELISA kit
E02A1754-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Atlastin 1(ATL1) ELISA kit
E02A1754-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Atlastin 1(ATL1) ELISA kit
E06A1754-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Atlastin 1(ATL1) ELISA kit
E06A1754-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Atlastin 1(ATL1) ELISA kit
E06A1754-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Atlastin 1(ATL1) ELISA kit
E03A1754-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Atlastin 1(ATL1) ELISA kit
E03A1754-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Atlastin 1(ATL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATL1 Rabbit Polyclonal Antibody