Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

DKK2 Rabbit Polyclonal Antibody

DKK2 Rabbit Polyclonal Antibody

Contact us: [email protected]

Polyclonal DKK2 Antibody
APC00093G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 . This antibody is tested and proven to work in the following applications:
DKK2 Polyclonal Antibody
ABP58377-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DKK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein
DKK2 Polyclonal Antibody
ABP58377-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DKK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein
DKK2 Polyclonal Antibody
ABP58377-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DKK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein
DKK2 Polyclonal Antibody
A56671 100 µg
EUR 570.55
Description: fast delivery possible
DKK2 Polyclonal Antibody
ES11076-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DKK2 Polyclonal Antibody
ES11076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DKK2 Rabbit pAb
A14874-100ul 100 ul
EUR 308
DKK2 Rabbit pAb
A14874-200ul 200 ul
EUR 459
DKK2 Rabbit pAb
A14874-20ul 20 ul
EUR 183
DKK2 Rabbit pAb
A14874-50ul 50 ul
EUR 223
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
DLR-DKK2-Hu-48T 48T
EUR 498
  • Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
DLR-DKK2-Hu-96T 96T
EUR 647
  • Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RDR-DKK2-Hu-48Tests 48 Tests
EUR 522
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RDR-DKK2-Hu-96Tests 96 Tests
EUR 724
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RD-DKK2-Hu-48Tests 48 Tests
EUR 500
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RD-DKK2-Hu-96Tests 96 Tests
EUR 692
Rabbit DKK2 ELISA Kit
ERTD0170 96Tests
EUR 521
DKK2 antibody
20R-1730 100 ug
EUR 673
Description: Rabbit polyclonal DKK2 antibody
DKK2 antibody
70R-12099 100 ug
EUR 403
Description: Rabbit polyclonal DKK2 antibody
DKK2 antibody
70R-12100 100 ug
EUR 403
Description: Rabbit polyclonal DKK2 antibody
DKK2 Antibody
35714-100ul 100ul
EUR 252
DKK2 Antibody
3802A-100
EUR 316
DKK2 Antibody
3802A-30T
EUR 146
DKK2 Antibody
3802R-100
EUR 316
DKK2 Antibody
3802R-30T
EUR 146
DKK2 Antibody
1-CSB-PA08279A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500
DKK2 Antibody
1-CSB-PA694579
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
DKK2 Antibody
DF12942 200ul
EUR 304
Description: DKK2 Antibody detects endogenous levels of DKK2.
DKK2 Antibody
1-CSB-PA284301
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
Polyclonal Dkk2 antibody - middle region
APC00094G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk2 - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-DKK2 Antibody
APR16264G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK2 . This antibody is tested and proven to work in the following applications:
Polyclonal DKK2 Antibody (N-term)
APR14288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 (N-term). This antibody is tested and proven to work in the following applications:
DKK2 Polyclonal Antibody, HRP Conjugated
A56672 100 µg
EUR 570.55
Description: reagents widely cited
DKK2 Polyclonal Antibody, FITC Conjugated
A56673 100 µg
EUR 570.55
Description: Ask the seller for details
DKK2 Polyclonal Antibody, Biotin Conjugated
A56674 100 µg
EUR 570.55
Description: The best epigenetics products
DKK2 Conjugated Antibody
C35714 100ul
EUR 397
anti- DKK2 antibody
FNab02402 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: dickkopf homolog 2
  • Uniprot ID: Q9UBU2
  • Gene ID: 27123
  • Research Area: Developmental biology
Description: Antibody raised against DKK2
Anti-DKK2 antibody
PAab02402 100 ug
EUR 355
Anti-DKK2 Antibody
PB9551 100ug/vial
EUR 294
Anti-DKK2 antibody
STJ117074 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).
Anti-DKK2 antibody
STJ192234 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DKK2
Anti-DKK2 antibody
STJ70136 100 µg
EUR 359
DKK2 siRNA
20-abx914198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DKK2 siRNA
20-abx914199
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DKK2 Antibody, HRP conjugated
1-CSB-PA08279B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DKK2 Antibody, FITC conjugated
1-CSB-PA08279C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DKK2 Antibody, Biotin conjugated
1-CSB-PA08279D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human)
4-PAB033Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2)
DKK2 Blocking Peptide
33R-10552 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 20R-1730
DKK2 Blocking Peptide
33R-10919 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 70R-12099
Dkk2 Blocking Peptide
3802BP-50
EUR 153
DKK2 Blocking Peptide
DF12942-BP 1mg
EUR 195
DKK2 cloning plasmid
CSB-CL866207HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtacca
  • Show more
Description: A cloning plasmid for the DKK2 gene.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC
4-PAB033Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Biotinylated
4-PAB033Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Cy3
4-PAB033Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), FITC
4-PAB033Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), HRP
4-PAB033Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), PE
4-PAB033Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE.
Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC-Cy7
4-PAB033Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC-Cy7.
Dickkopf Related Protein 2 (DKK2) Antibody
20-abx212865
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dickkopf Related Protein 2 (DKK2) Antibody
20-abx213438
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dickkopf Related Protein 2 (DKK2) Antibody
20-abx102610
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Dickkopf Related Protein 2 (DKK2) Antibody
20-abx172115
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dickkopf-Related Protein 2 (DKK2) Antibody
20-abx306432
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DKK2 protein (His tag)
80R-2444 20 ug
EUR 322
Description: Purified recombinant DKK2 protein (His tag)
Human DKK2 ELISA Kit
EHD0170 96Tests
EUR 521
Goat DKK2 ELISA Kit
EGTD0170 96Tests
EUR 521
Bovine DKK2 ELISA Kit
EBD0170 96Tests
EUR 521
Canine DKK2 ELISA Kit
ECD0170 96Tests
EUR 521
Chicken DKK2 ELISA Kit
ECKD0170 96Tests
EUR 521
Anserini DKK2 ELISA Kit
EAD0170 96Tests
EUR 521
Human DKK2 ELISA Kit
ELA-E9039h 96 Tests
EUR 824
DKK2 ELISA KIT|Human
EF006472 96 Tests
EUR 689
Mouse DKK2 shRNA Plasmid
20-abx974917
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DKK2 shRNA Plasmid
20-abx958977
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse DKK2 ELISA Kit
EMD0170 96Tests
EUR 521
Rat DKK2 ELISA Kit
ERD0170 96Tests
EUR 521
Sheep DKK2 ELISA Kit
ESD0170 96Tests
EUR 521
Monkey DKK2 ELISA Kit
EMKD0170 96Tests
EUR 521
Porcine DKK2 ELISA Kit
EPD0170 96Tests
EUR 521
DKK2 Recombinant Protein (Human)
RP038533 100 ug Ask for price
DKK2 Recombinant Protein (Rat)
RP198113 100 ug Ask for price
DKK2 Recombinant Protein (Mouse)
RP129131 100 ug Ask for price
Rabbit Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) ELISA Kit
abx362747-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx122683-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028487-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028487-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028488-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dickkopf Related Protein 2 (DKK2) Antibody (Biotin)
20-abx272078
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx432609-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Dickkopf-Related Protein 2 (DKK2) Antibody (HRP)
20-abx306433
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dickkopf-Related Protein 2 (DKK2) Antibody (FITC)
20-abx306434
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dickkopf-Related Protein 2 (DKK2) Antibody (Biotin)
20-abx306435
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx232402-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Guinea Pig DKK2 ELISA Kit
EGD0170 96Tests
EUR 521
Dkk2 ORF Vector (Rat) (pORF)
ORF066039 1.0 ug DNA
EUR 506

DKK2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages