DKK2 Rabbit Polyclonal Antibody

Contact us: [email protected]

Polyclonal DKK2 Antibody
APC00093G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 . This antibody is tested and proven to work in the following applications:

DKK2 Polyclonal Antibody
ABP58377-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human DKK2 protein Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein

DKK2 Polyclonal Antibody
ABP58377-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DKK2 protein Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein

DKK2 Polyclonal Antibody
ABP58377-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DKK2 protein Applications tips:
Description: A polyclonal antibody for detection of DKK2 from Human, Mouse. This DKK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK2 protein

DKK2 Polyclonal Antibody
A56671	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

DKK2 Polyclonal Antibody
ES11076-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK2 Polyclonal Antibody
ES11076-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK2 Rabbit pAb
A14874-100ul	Abclonal	100 ul	EUR 308

DKK2 Rabbit pAb
A14874-200ul	Abclonal	200 ul	EUR 459

DKK2 Rabbit pAb
A14874-20ul	Abclonal	20 ul	EUR 183

DKK2 Rabbit pAb
A14874-50ul	Abclonal	50 ul	EUR 223

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
DLR-DKK2-Hu-48T	DL Develop	48T	EUR 498
Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
DLR-DKK2-Hu-96T	DL Develop	96T	EUR 647
Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RDR-DKK2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RDR-DKK2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RD-DKK2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit
RD-DKK2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rabbit DKK2 ELISA Kit
ERTD0170	Abclonal	96Tests	EUR 521

DKK2 antibody
20R-1730	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal DKK2 antibody

DKK2 antibody
70R-12099	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal DKK2 antibody

DKK2 antibody
70R-12100	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal DKK2 antibody

DKK2 Antibody
35714-100ul	SAB	100ul	EUR 252

DKK2 Antibody
3802A-100	Biovision		EUR 316

DKK2 Antibody
3802A-30T	Biovision		EUR 146

DKK2 Antibody
3802R-100	Biovision		EUR 316

DKK2 Antibody
3802R-30T	Biovision		EUR 146

DKK2 Antibody
1-CSB-PA08279A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

DKK2 Antibody
1-CSB-PA694579	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DKK2 Antibody
DF12942	Affbiotech	200ul	EUR 304
Description: DKK2 Antibody detects endogenous levels of DKK2.

DKK2 Antibody
1-CSB-PA284301	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal Dkk2 antibody - middle region
APC00094G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DKK2 Antibody
APR16264G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK2 . This antibody is tested and proven to work in the following applications:

Polyclonal DKK2 Antibody (N-term)
APR14288G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 (N-term). This antibody is tested and proven to work in the following applications:

DKK2 Polyclonal Antibody, HRP Conjugated
A56672	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

DKK2 Polyclonal Antibody, FITC Conjugated
A56673	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DKK2 Polyclonal Antibody, Biotin Conjugated
A56674	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DKK2 Conjugated Antibody
C35714	SAB	100ul	EUR 397

anti- DKK2 antibody
FNab02402	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: dickkopf homolog 2 Uniprot ID: Q9UBU2 Gene ID: 27123 Research Area: Developmental biology
Description: Antibody raised against DKK2

Anti-DKK2 antibody
PAab02402	Lifescience Market	100 ug	EUR 355

Anti-DKK2 Antibody
PB9551	BosterBio	100ug/vial	EUR 294

Anti-DKK2 antibody
STJ117074	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).

Anti-DKK2 antibody
STJ192234	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DKK2

Anti-DKK2 antibody
STJ70136	St John's Laboratory	100 µg	EUR 359

DKK2 siRNA
20-abx914198	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DKK2 siRNA
20-abx914199	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DKK2 Antibody, HRP conjugated
1-CSB-PA08279B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DKK2 Antibody, FITC conjugated
1-CSB-PA08279C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DKK2 Antibody, Biotin conjugated
1-CSB-PA08279D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human)
4-PAB033Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2)

DKK2 Blocking Peptide
33R-10552	Fitzgerald	50 ug	EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 20R-1730

DKK2 Blocking Peptide
33R-10919	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 70R-12099

Dkk2 Blocking Peptide
3802BP-50	Biovision		EUR 153

DKK2 Blocking Peptide
DF12942-BP	Affbiotech	1mg	EUR 195

DKK2 cloning plasmid
CSB-CL866207HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 780 Sequence: atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtacca Show more
Description: A cloning plasmid for the DKK2 gene.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC
4-PAB033Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Biotinylated
4-PAB033Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Cy3
4-PAB033Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), FITC
4-PAB033Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), HRP
4-PAB033Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), PE
4-PAB033Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC-Cy7
4-PAB033Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK2 (Asp159~Lys258) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC-Cy7.

Dickkopf Related Protein 2 (DKK2) Antibody
20-abx212865	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody
20-abx213438	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody
20-abx102610	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Dickkopf Related Protein 2 (DKK2) Antibody
20-abx172115	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody
20-abx306432	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DKK2 protein (His tag)
80R-2444	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant DKK2 protein (His tag)

Human DKK2 ELISA Kit
EHD0170	Abclonal	96Tests	EUR 521

Goat DKK2 ELISA Kit
EGTD0170	Abclonal	96Tests	EUR 521

Bovine DKK2 ELISA Kit
EBD0170	Abclonal	96Tests	EUR 521

Canine DKK2 ELISA Kit
ECD0170	Abclonal	96Tests	EUR 521

Chicken DKK2 ELISA Kit
ECKD0170	Abclonal	96Tests	EUR 521

Anserini DKK2 ELISA Kit
EAD0170	Abclonal	96Tests	EUR 521

Human DKK2 ELISA Kit
ELA-E9039h	Lifescience Market	96 Tests	EUR 824

DKK2 ELISA KIT|Human
EF006472	Lifescience Market	96 Tests	EUR 689

Mouse DKK2 shRNA Plasmid
20-abx974917	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DKK2 shRNA Plasmid
20-abx958977	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DKK2 ELISA Kit
EMD0170	Abclonal	96Tests	EUR 521

Rat DKK2 ELISA Kit
ERD0170	Abclonal	96Tests	EUR 521

Sheep DKK2 ELISA Kit
ESD0170	Abclonal	96Tests	EUR 521

Monkey DKK2 ELISA Kit
EMKD0170	Abclonal	96Tests	EUR 521

Porcine DKK2 ELISA Kit
EPD0170	Abclonal	96Tests	EUR 521

DKK2 Recombinant Protein (Human)
RP038533	ABM	100 ug	Ask for price

DKK2 Recombinant Protein (Rat)
RP198113	ABM	100 ug	Ask for price

DKK2 Recombinant Protein (Mouse)
RP129131	ABM	100 ug	Ask for price

Rabbit Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) ELISA Kit
abx362747-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx122683-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028487-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028487-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028488-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx028488-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody (Biotin)
20-abx272078	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx432609-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (HRP)
20-abx306433	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (FITC)
20-abx306434	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (Biotin)
20-abx306435	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody
abx232402-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Guinea Pig DKK2 ELISA Kit
EGD0170	Abclonal	96Tests	EUR 521

Dkk2 ORF Vector (Rat) (pORF)
ORF066039	ABM	1.0 ug DNA	EUR 506

DKK2 Rabbit Polyclonal Antibody