Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

CISD2 Rabbit Polyclonal Antibody

CISD2 Rabbit Polyclonal Antibody

Contact us: [email protected]

CISD2 Polyclonal Antibody
30644-50ul 50ul
EUR 187
CISD2 Polyclonal Antibody
28451-100ul 100ul
EUR 252
CISD2 Polyclonal Antibody
28451-50ul 50ul
EUR 187
Polyclonal CISD2 Antibody
APR15451G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CISD2 . This antibody is tested and proven to work in the following applications:
CISD2 Polyclonal Antibody
A66626 100 µg
EUR 570.55
Description: fast delivery possible
CISD2 Polyclonal Antibody
ABP58160-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CISD2 from Human, Mouse. This CISD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
CISD2 Polyclonal Antibody
ABP58160-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CISD2 from Human, Mouse. This CISD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
CISD2 Polyclonal Antibody
ABP58160-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of CISD2 from Human, Mouse. This CISD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
CISD2 Polyclonal Antibody
ES11428-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CISD2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CISD2 Polyclonal Antibody
ES11428-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CISD2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CISD2 Rabbit pAb
A14168-100ul 100 ul
EUR 308
CISD2 Rabbit pAb
A14168-200ul 200 ul
EUR 459
CISD2 Rabbit pAb
A14168-20ul 20 ul
EUR 183
CISD2 Rabbit pAb
A14168-50ul 50 ul
EUR 223
CISD2 Rabbit pAb
A5231-100ul 100 ul
EUR 308
CISD2 Rabbit pAb
A5231-200ul 200 ul
EUR 459
CISD2 Rabbit pAb
A5231-20ul 20 ul
EUR 183
CISD2 Rabbit pAb
A5231-50ul 50 ul
EUR 223
CISD2 Polyclonal Conjugated Antibody
C28451 100ul
EUR 397
CISD2 Polyclonal Conjugated Antibody
C30644 100ul
EUR 397
CISD2 antibody
70R-16427 50 ul
EUR 435
Description: Rabbit polyclonal CISD2 antibody
CISD2 Antibody
1-CSB-PA839803LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
CISD2 Antibody
1-CSB-PA005443GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CISD2 Antibody
DF12096 200ul
EUR 304
Description: CISD2 antibody detects endogenous levels of CISD2.
CISD2 antibody
70R-6583 50 ug
EUR 467
Description: Rabbit polyclonal CISD2 antibody raised against the N terminal of CISD2
CISD2 Polyclonal Antibody, HRP Conjugated
A66627 100 µg
EUR 570.55
Description: reagents widely cited
CISD2 Polyclonal Antibody, FITC Conjugated
A66628 100 µg
EUR 570.55
Description: Ask the seller for details
CISD2 Polyclonal Antibody, Biotin Conjugated
A66629 100 µg
EUR 570.55
Description: The best epigenetics products
Polyclonal CISD2 antibody - N-terminal region
APR15452G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CISD2 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal NAF-1 / CISD2 Antibody (Internal)
APR17526G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAF-1 / CISD2 (Internal). This antibody is tested and proven to work in the following applications:
CISD2-Specific Antibody
abx231719-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
anti- CISD2 antibody
FNab01718 100µg
EUR 505.25
  • Immunogen: CDGSH iron sulfur domain 2
  • Uniprot ID: Q8N5K1
  • Gene ID: 493856
  • Research Area: Signal Transduction
Description: Antibody raised against CISD2
Anti-CISD2 antibody
PAab01718 100 ug
EUR 355
Anti-CISD2 antibody
STJ27203 100 µl
EUR 277
Description: The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2.
Anti-CISD2 antibody
STJ116103 100 µl
EUR 277
Description: The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2.
Anti-CISD2 antibody
STJ192586 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CISD2
CISD2 siRNA
20-abx911885
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CISD2 siRNA
20-abx911886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CISD2 Antibody, HRP conjugated
1-CSB-PA839803LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CISD2 Antibody, FITC conjugated
1-CSB-PA839803LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CISD2 Antibody, Biotin conjugated
1-CSB-PA839803LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
anti- CISD2-Specific antibody
FNab01719 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:16000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: CDGSH iron sulfur domain 2
  • Uniprot ID: Q8N5K1
  • Research Area: Signal Transduction
Description: Antibody raised against CISD2-Specific
CISD2 Blocking Peptide
33R-9652 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CISD2 antibody, catalog no. 70R-6583
CISD2 Blocking Peptide
DF12096-BP 1mg
EUR 195
CISD2 cloning plasmid
CSB-CL839803HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggtgctggagagcgtggcccgtatcgtgaaggtgcagctccctgcatatctgaagcggctcccagtccctgaaagcattaccgggttcgctaggctcacagtttcagaatggcttcggttattgcctttccttggtgtactcgcacttcttggctaccttgcagttcgtccatt
  • Show more
Description: A cloning plasmid for the CISD2 gene.
Bovine CISD2 ELISA KIT
ELI-10627b 96 Tests
EUR 928
Mouse Cisd2 ELISA KIT
ELI-10628m 96 Tests
EUR 865
Human CISD2 ELISA KIT
ELI-10975h 96 Tests
EUR 824
CISD2 ELISA KIT|Human
EF008690 96 Tests
EUR 689
Mouse CISD2 shRNA Plasmid
20-abx975914
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CISD2 shRNA Plasmid
20-abx968356
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CISD2 Recombinant Protein (Human)
RP007168 100 ug Ask for price
CISD2 Recombinant Protein (Rat)
RP195095 100 ug Ask for price
CISD2 Recombinant Protein (Mouse)
RP124238 100 ug Ask for price
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody
20-abx004018
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody
20-abx111510
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody
20-abx317989
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody
abx231718-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Cisd2 ORF Vector (Rat) (pORF)
ORF065033 1.0 ug DNA
EUR 506
CISD2 ORF Vector (Human) (pORF)
ORF002390 1.0 ug DNA
EUR 95
Cisd2 ORF Vector (Mouse) (pORF)
ORF041414 1.0 ug DNA
EUR 506
CISD2 ELISA Kit (Mouse) (OKCA01642)
OKCA01642 96 Wells
EUR 846
Description: Description of target: Regulator of autophagy that contributes to antagonize BECN1-mediated cellular autophagy at the endoplasmic reticulum. Participates in the interaction of BCL2 with BECN1 and is required for BCL2-mediated depression of endoplasmic reticulum Ca2+ stores during autophagy. Contributes to BIK-initiated autophagy, while it is not involved in BIK-dependent activation of caspases. Involved in life span control, probably via its function as regulator of autophagy.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 11.75 pg/mL
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (HRP)
20-abx309416
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (FITC)
20-abx309417
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (Biotin)
20-abx309418
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit
E04C0925-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit
E04C0925-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit
E04C0925-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
CISD2 sgRNA CRISPR Lentivector set (Human)
K0454401 3 x 1.0 ug
EUR 339
Cisd2 sgRNA CRISPR Lentivector set (Mouse)
K4949301 3 x 1.0 ug
EUR 339
Cisd2 sgRNA CRISPR Lentivector set (Rat)
K6206601 3 x 1.0 ug
EUR 339
CISD2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0454402 1.0 ug DNA
EUR 154
CISD2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0454403 1.0 ug DNA
EUR 154
CISD2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0454404 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4949302 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4949303 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4949304 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6206602 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6206603 1.0 ug DNA
EUR 154
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6206604 1.0 ug DNA
EUR 154
CISD2 Protein Vector (Mouse) (pPB-C-His)
PV165654 500 ng
EUR 603
CISD2 Protein Vector (Mouse) (pPB-N-His)
PV165655 500 ng
EUR 603
CISD2 Protein Vector (Mouse) (pPM-C-HA)
PV165656 500 ng
EUR 603
CISD2 Protein Vector (Mouse) (pPM-C-His)
PV165657 500 ng
EUR 603
CISD2 Protein Vector (Rat) (pPB-C-His)
PV260130 500 ng
EUR 603
CISD2 Protein Vector (Rat) (pPB-N-His)
PV260131 500 ng
EUR 603
CISD2 Protein Vector (Rat) (pPM-C-HA)
PV260132 500 ng
EUR 603
CISD2 Protein Vector (Rat) (pPM-C-His)
PV260133 500 ng
EUR 603
CISD2 Protein Vector (Human) (pPB-C-His)
PV009557 500 ng
EUR 329
CISD2 Protein Vector (Human) (pPB-N-His)
PV009558 500 ng
EUR 329
CISD2 Protein Vector (Human) (pPM-C-HA)
PV009559 500 ng
EUR 329
CISD2 Protein Vector (Human) (pPM-C-His)
PV009560 500 ng
EUR 329
Cisd2 3'UTR GFP Stable Cell Line
TU153920 1.0 ml Ask for price
Cisd2 3'UTR Luciferase Stable Cell Line
TU103920 1.0 ml Ask for price
Cisd2 3'UTR Luciferase Stable Cell Line
TU202372 1.0 ml Ask for price
Cisd2 3'UTR GFP Stable Cell Line
TU252372 1.0 ml Ask for price
CISD2 3'UTR GFP Stable Cell Line
TU054468 1.0 ml
EUR 1521
CISD2 3'UTR Luciferase Stable Cell Line
TU004468 1.0 ml
EUR 1521
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

CISD2 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages