Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


MFAP5 Rabbit Polyclonal Antibody

MFAP5 Rabbit Polyclonal Antibody

Contact us: [email protected]

MFAP5 Polyclonal Antibody

ES11328-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MFAP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MFAP5 Polyclonal Antibody

ES11328-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MFAP5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MFAP5 antibody

70R-18492 50 ul
EUR 435
Description: Rabbit polyclonal MFAP5 antibody

MFAP5 Antibody

37713-100ul 100ul
EUR 252

MFAP5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MFAP5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MFAP5 Antibody

DF13146 200ul
EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody

DF12539 200ul
EUR 304
Description: MFAP5 Antibody detects endogenous levels of MFAP5.

MFAP5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MFAP5 Polyclonal Antibody, HRP Conjugated

A56135 100 µg
EUR 570.55
Description: fast delivery possible

MFAP5 Polyclonal Antibody, FITC Conjugated

A56136 100 µg
EUR 570.55
Description: reagents widely cited

MFAP5 Polyclonal Antibody, Biotin Conjugated

A56137 100 µg
EUR 570.55
Description: Ask the seller for details

MFAP5 Conjugated Antibody

C37713 100ul
EUR 397

anti- MFAP5 antibody

FNab05147 100µg
EUR 548.75
  • Immunogen: microfibrillar associated protein 5
  • Uniprot ID: Q13361
  • Gene ID: 8076
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against MFAP5

Anti-MFAP5 antibody

PAab05147 100 ug
EUR 386

Anti-MFAP5 antibody

STJ192486 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MFAP5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFAP5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFAP5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFAP5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFAP5. Recognizes MFAP5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5)

MFAP5 Blocking Peptide

DF13146-BP 1mg
EUR 195

MFAP5 Blocking Peptide

DF12539-BP 1mg
EUR 195

MFAP5 cloning plasmid

CSB-CL623799HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 522
  • Sequence: atgtcgctcttgggacccaaggtgctgctgtttcttgctgcattcatcatcacctctgactggatacccctgggggtcaatagtcaacgaggagacgatgtgactcaagcgactccagaaacattcacagaagatcctaatctggtgaatgatcccgctacagatgaaacagtttt
  • Show more
Description: A cloning plasmid for the MFAP5 gene.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5)

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

abx122837-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody

abx235147-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.


ELA-E11955h 96 Tests
EUR 824


EF004275 96 Tests
EUR 689

Mouse MFAP5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MFAP5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFAP5 Recombinant Protein (Human)

RP019240 100 ug Ask for price

MFAP5 Recombinant Protein (Mouse)

RP150392 100 ug Ask for price

MFAP5 Recombinant Protein (Rat)

RP211505 100 ug Ask for price

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Gly25~Pro152)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Biotin.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with Cy3.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with FITC.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with HRP.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with PE.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Leu24~Cys162)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFAP5 (Asp32~Asp164)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Microfibrillar Associated Protein 5 (MFAP5). This antibody is labeled with APC-Cy7.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Microfibrillar Associated Protein 5 (MFAP5) Antibody Pair

  • EUR 1887.00
  • EUR 1191.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Mfap5 ORF Vector (Rat) (pORF)

ORF070503 1.0 ug DNA
EUR 506

MFAP5 ORF Vector (Human) (pORF)

ORF006414 1.0 ug DNA
EUR 95

Mfap5 ORF Vector (Mouse) (pORF)

ORF050132 1.0 ug DNA
EUR 506

MFAP5 ELISA Kit (Mouse) (OKCA02409)

OKCA02409 96 Wells
EUR 846
Description: Description of target: May play a role in hematopoiesis. In the cardiovascular system, could regulate growth factors or participate in cell signaling in maintaining large vessel integrity . Component of the elastin-associated microfibrils.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 ng/mL

MFAP5 ELISA Kit (Rat) (OKCD08814)

OKCD08814 96 Wells
EUR 1053
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

MFAP5 ELISA Kit (Mouse) (OKEH05621)

OKEH05621 96 Wells
EUR 779
Description: Description of target: May play a role in hematopoiesis. In the cardiovascular system, could regulate growth factors or participate in cell signaling in maintaining large vessel integrity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

MFAP5 ELISA Kit (Bovine) (OKEH07786)

OKEH07786 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

MFAP5 ELISA Kit (Human) (OKEH02193)

OKEH02193 96 Wells
EUR 662
Description: Description of target: This gene encodes a 25-kD microfibril-associated glycoprotein which is a component of microfibrils of the extracellular matrix. The encoded protein promotes attachment of cells to microfibrils via alpha-V-beta-3 integrin. Deficiency of this gene in mice results in neutropenia. Alternate splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Human Microfibrillar-associated protein 5 (MFAP5)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 33.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Microfibrillar-associated protein 5(MFAP5) expressed in E.coli

Mfap5 sgRNA CRISPR Lentivector set (Rat)

K6495801 3 x 1.0 ug
EUR 339

MFAP5 sgRNA CRISPR Lentivector set (Human)

K1295901 3 x 1.0 ug
EUR 339

MFAP5 Rabbit Polyclonal Antibody

Recent Posts


January 2022
