Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


PILRB Rabbit Polyclonal Antibody

PILRB Rabbit Polyclonal Antibody

Contact us: [email protected]

PILRB Polyclonal Antibody

ABP59916-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PILRB from Human, Mouse. This PILRB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PILRB protein at amino acid sequence of 170-250

PILRB Polyclonal Antibody

ES11311-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PILRB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PILRB Polyclonal Antibody

ES11311-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PILRB from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PILRB Antibody

36695-100ul 100ul
EUR 252

PILRB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PILRB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PILRB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:20-1:100

PILRB antibody

70R-7227 50 ug
EUR 467
Description: Rabbit polyclonal PILRB antibody raised against the middle region of PILRB

Polyclonal PILRB antibody - middle region

AMM07195G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PILRB - middle region. This antibody is tested and proven to work in the following applications:

PILRB Polyclonal Antibody, HRP Conjugated

A68027 100 µg
EUR 570.55
Description: The best epigenetics products

PILRB Polyclonal Antibody, FITC Conjugated

A68028 100 µg
EUR 570.55
Description: kits suitable for this type of research

PILRB Polyclonal Antibody, Biotin Conjugated

A68029 100 µg
EUR 570.55
Description: fast delivery possible

PILRB Conjugated Antibody

C36695 100ul
EUR 397

Anti-PILRB antibody

STJ192469 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PILRB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PILRB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PILRB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PILRB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PILRB. Recognizes PILRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PILRB Blocking Peptide

33R-4545 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PILRB antibody, catalog no. 70R-7227

PILRB cloning plasmid

CSB-CL890735HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggtcggcccctgctgctgcccctgctgctcctgctgcagccgccagcatttctgcagcctggtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctg
  • Show more
Description: A cloning plasmid for the PILRB gene.


ELA-E13291h 96 Tests
EUR 824


EF005352 96 Tests
EUR 689


ELI-45043h 96 Tests
EUR 824

Mouse Pilrb ELISA KIT

ELI-45044m 96 Tests
EUR 865

Human PILRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PILRB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PILRB Recombinant Protein (Human)

RP023521 100 ug Ask for price

PILRB ORF Vector (Human) (pORF)

ORF007841 1.0 ug DNA
EUR 95

PILRB ELISA Kit (Mouse) (OKEH05560)

OKEH05560 96 Wells
EUR 779
Description: Description of target: Paired receptors consist of highly related activating and inhibitory receptors and are widely involved in the regulation of the immune system. PILRB is thought to act as a cellular signaling activating receptor that associates with ITAM-bearing adapter molecules on the cell surface. Seems to associate with DAP12 and is a receptor for CD99. May be involved in target cell recognition by natural killer cells and in activation of dendritic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL

PILRB ELISA Kit (Human) (OKEH02298)

OKEH02298 96 Wells
EUR 662
Description: Description of target: The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

PILRB sgRNA CRISPR Lentivector set (Human)

K1651301 3 x 1.0 ug
EUR 339

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired immunoglobulin-like type 2 receptor beta (PILRB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PILRB sgRNA CRISPR Lentivector (Human) (Target 1)

K1651302 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 2)

K1651303 1.0 ug DNA
EUR 154

PILRB sgRNA CRISPR Lentivector (Human) (Target 3)

K1651304 1.0 ug DNA
EUR 154

PILRB Protein Vector (Human) (pPB-C-His)

PV031361 500 ng
EUR 329

PILRB Protein Vector (Human) (pPB-N-His)

PV031362 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-HA)

PV031363 500 ng
EUR 329

PILRB Protein Vector (Human) (pPM-C-His)

PV031364 500 ng
EUR 329

PILRB 3'UTR GFP Stable Cell Line

TU067973 1.0 ml
EUR 2333

PILRB 3'UTR Luciferase Stable Cell Line

TU017973 1.0 ml
EUR 2333

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paired Immunoglobulin-Like Type 2 Receptor Beta (PILRB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

PILRB Rabbit Polyclonal Antibody

Recent Posts


January 2022
