Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

FLRT1 Rabbit Polyclonal Antibody

FLRT1 Rabbit Polyclonal Antibody

Contact us: [email protected]

FLRT1 Polyclonal Antibody

ABP58571-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FLRT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT1 from Human. This FLRT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT1 protein

FLRT1 Polyclonal Antibody

ABP58571-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FLRT1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FLRT1 from Human. This FLRT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT1 protein

FLRT1 Polyclonal Antibody

ES11084-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FLRT1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT1 Polyclonal Antibody

ES11084-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FLRT1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FLRT1 antibody

23122-100ul 100ul
EUR 390

FLRT1 antibody

70R-12906 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal FLRT1 antibody

FLRT1 Antibody

1-CSB-PA865196EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT1. Recognizes FLRT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FLRT1 Polyclonal Antibody, HRP Conjugated

A51262 100 µg
EUR 570.55
Description: Ask the seller for details

FLRT1 Polyclonal Antibody, FITC Conjugated

A51263 100 µg
EUR 570.55
Description: The best epigenetics products

FLRT1 Polyclonal Antibody, Biotin Conjugated

A51264 100 µg
EUR 570.55
Description: kits suitable for this type of research

FLRT1 Antibody (HRP)

20-abx310879
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FLRT1 Antibody (FITC)

20-abx310880
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FLRT1 Antibody (Biotin)

20-abx310881
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-FLRT1 antibody

STJ192242 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT1

Leucine-Rich Repeat Transmembrane Protein FLRT1 (FLRT1) Antibody

20-abx318418
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FLRT1 siRNA

20-abx916976
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLRT1 Antibody, HRP conjugated

1-CSB-PA865196EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT1. Recognizes FLRT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FLRT1 Antibody, FITC conjugated

1-CSB-PA865196EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT1. Recognizes FLRT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FLRT1 Antibody, Biotin conjugated

1-CSB-PA865196ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FLRT1. Recognizes FLRT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FLRT1 Protein

20-abx650959
  • EUR 495.00
  • EUR 244.00
  • EUR 1372.00
  • EUR 565.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse FLRT1 Protein

20-abx650960
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FLRT1 cloning plasmid

CSB-CL865196HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2025
  • Sequence: atggtggtggcacaccccaccgccactgccaccaccacgcccactgccactgtcacggccaccgttgtgatgaccacggccaccatggacctgcgggactggctgttcctctgctacgggctcatcgccttcctgacggaggtcatcgacagcaccacctgcccctcggtgtgcc
  • Show more
Description: A cloning plasmid for the FLRT1 gene.

pCMV-SPORT6-FLRT1

PVT13767 2 ug
EUR 391

Anti-FLRT1 (4E10)

YF-MA17984 100 ug
EUR 363
Description: Mouse monoclonal to FLRT1

Human FLRT1 shRNA Plasmid

20-abx958457
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FLRT1 ELISA KIT

ELI-47341h 96 Tests
EUR 824

FLRT1 Recombinant Protein (Human)

RP012352 100 ug Ask for price

FLRT1 Recombinant Protein (Rat)

RP201536 100 ug Ask for price

FLRT1 Recombinant Protein (Mouse)

RP134798 100 ug Ask for price

Flrt1 ORF Vector (Rat) (pORF)

ORF067180 1.0 ug DNA
EUR 506

FLRT1 ORF Vector (Human) (pORF)

ORF004118 1.0 ug DNA
EUR 95

Flrt1 ORF Vector (Mouse) (pORF)

ORF044934 1.0 ug DNA
EUR 506

Flrt1 sgRNA CRISPR Lentivector set (Rat)

K6133801 3 x 1.0 ug
EUR 339

FLRT1 sgRNA CRISPR Lentivector set (Human)

K0787801 3 x 1.0 ug
EUR 339

Flrt1 sgRNA CRISPR Lentivector set (Mouse)

K4599401 3 x 1.0 ug
EUR 339

Flrt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6133802 1.0 ug DNA
EUR 154

Flrt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6133803 1.0 ug DNA
EUR 154

Flrt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6133804 1.0 ug DNA
EUR 154

FLRT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0787802 1.0 ug DNA
EUR 154

FLRT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0787803 1.0 ug DNA
EUR 154

FLRT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0787804 1.0 ug DNA
EUR 154

Flrt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4599402 1.0 ug DNA
EUR 154

Flrt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4599403 1.0 ug DNA
EUR 154

Flrt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4599404 1.0 ug DNA
EUR 154

FLRT1 Protein Vector (Mouse) (pPB-C-His)

PV179734 500 ng
EUR 1065

FLRT1 Protein Vector (Mouse) (pPB-N-His)

PV179735 500 ng
EUR 1065

FLRT1 Protein Vector (Mouse) (pPM-C-HA)

PV179736 500 ng
EUR 1065

FLRT1 Protein Vector (Mouse) (pPM-C-His)

PV179737 500 ng
EUR 1065

FLRT1 Protein Vector (Rat) (pPB-C-His)

PV268718 500 ng
EUR 1191

FLRT1 Protein Vector (Rat) (pPB-N-His)

PV268719 500 ng
EUR 1191

FLRT1 Protein Vector (Rat) (pPM-C-HA)

PV268720 500 ng
EUR 1191

FLRT1 Protein Vector (Rat) (pPM-C-His)

PV268721 500 ng
EUR 1191

FLRT1 Protein Vector (Human) (pPB-C-His)

PV016469 500 ng
EUR 329

FLRT1 Protein Vector (Human) (pPB-N-His)

PV016470 500 ng
EUR 329

FLRT1 Protein Vector (Human) (pPM-C-HA)

PV016471 500 ng
EUR 329

FLRT1 Protein Vector (Human) (pPM-C-His)

PV016472 500 ng
EUR 329

Flrt1 3'UTR GFP Stable Cell Line

TU156620 1.0 ml Ask for price

Flrt1 3'UTR Luciferase Stable Cell Line

TU106620 1.0 ml Ask for price

Flrt1 3'UTR Luciferase Stable Cell Line

TU204682 1.0 ml Ask for price

Flrt1 3'UTR GFP Stable Cell Line

TU254682 1.0 ml Ask for price

FLRT1 3'UTR GFP Stable Cell Line

TU058025 1.0 ml
EUR 1394

FLRT1 3'UTR Luciferase Stable Cell Line

TU008025 1.0 ml
EUR 1394

Recombinant Fibronectin Leucine Rich Transmembrane Protein 1 (FLRT1)

4-RPF454Hu01
  • EUR 341.92
  • EUR 194.00
  • EUR 1007.20
  • EUR 402.40
  • EUR 704.80
  • EUR 292.00
  • EUR 2368.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NZU1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.0kDa
  • Isoelectric Point: 5.3
Description: Recombinant Human Fibronectin Leucine Rich Transmembrane Protein 1 expressed in: E.coli

Recombinant Fibronectin Leucine Rich Transmembrane Protein 1 (FLRT1)

4-RPF454Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6RKD8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.0kDa
  • Isoelectric Point: 5.2
Description: Recombinant Mouse Fibronectin Leucine Rich Transmembrane Protein 1 expressed in: E.coli

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

FLRT1 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages