Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

VSIG4 Rabbit Polyclonal Antibody

VSIG4 Rabbit Polyclonal Antibody

Contact us: [email protected]

VSIG4 Polyclonal Antibody

ES11181-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VSIG4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

VSIG4 antibody

70R-1905 100 ug
EUR 377
Description: Rabbit polyclonal VSIG4 antibody raised against the N terminal of VSIG4

VSIG4 Antibody

1-CSB-PA896869LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal VSIG4 Antibody (C-term)

APR04368G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VSIG4 (C-term). This antibody is tested and proven to work in the following applications:

VSIG4 Antibody (HRP)

20-abx316697
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VSIG4 Antibody (FITC)

20-abx316698
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VSIG4 Antibody (Biotin)

20-abx316699
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-VSIG4 antibody

STJ192339 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VSIG4

VSIG4 siRNA

20-abx939568
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VSIG4 Antibody, HRP conjugated

1-CSB-PA896869LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VSIG4 Antibody, FITC conjugated

1-CSB-PA896869LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VSIG4 Antibody, Biotin conjugated

1-CSB-PA896869LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VSIG4 Blocking Peptide

33R-9726 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSIG4 antibody, catalog no. 70R-1905

VSIG4 cloning plasmid

CSB-CL896869HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atggggatcttactgggcctgctactcctggggcacctaacagtggacacttatggccgtcccatcctggaagtgccagagagtgtaacaggaccttggaaaggggatgtgaatcttccctgcacctatgaccccctgcaaggctacacccaagtcttggtgaagtggctggtac
  • Show more
Description: A cloning plasmid for the VSIG4 gene.

Human VSIG4 ELISA KIT

ELI-15017h 96 Tests
EUR 824

Human VSIG4 shRNA Plasmid

20-abx957754
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VSIG4 Recombinant Protein (Rat)

RP237083 100 ug Ask for price

Recombinant Human VSIG4 Protein

RP00286 20 μg
EUR 202

VSIG4 Recombinant Protein (Mouse)

RP185009 100 ug Ask for price

Recombinant Mouse VSIG4 (C-6His)

CP83-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-500ug 500ug
EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human CellExp? VSIG4, human recombinant

P1018-10
EUR 207

Human CellExp? VSIG4, human recombinant

P1018-50
EUR 479

Vsig4 ORF Vector (Mouse) (pORF)

ORF061671 1.0 ug DNA
EUR 506

Vsig4 ORF Vector (Rat) (pORF)

ORF079029 1.0 ug DNA
EUR 506

VSIG4 ORF Vector (Human) (pORF)

ORF011484 1.0 ug DNA
EUR 95

VSIG4 ELISA Kit (Human) (OKCA00860)

OKCA00860 96 Wells
EUR 833
Description: Description of target: Phagocytic receptor, strong negative regulator of T-cell proliferation and IL2 production. Potent inhibitor of the alternative complement pathway convertases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL

VSIG4 ELISA Kit (Human) (OKEH08599)

OKEH08599 96 Wells
EUR 896
Description: Description of target: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22ng/ml

Vsig4 sgRNA CRISPR Lentivector set (Rat)

K7367501 3 x 1.0 ug
EUR 339

VSIG4 sgRNA CRISPR Lentivector set (Human)

K2620901 3 x 1.0 ug
EUR 339

Vsig4 sgRNA CRISPR Lentivector set (Mouse)

K4242501 3 x 1.0 ug
EUR 339

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7367502 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7367503 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7367504 1.0 ug DNA
EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2620902 1.0 ug DNA
EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2620903 1.0 ug DNA
EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2620904 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4242502 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4242503 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4242504 1.0 ug DNA
EUR 154

VSIG4 Protein Vector (Mouse) (pPB-C-His)

PV246682 500 ng
EUR 603

VSIG4 Protein Vector (Mouse) (pPB-N-His)

PV246683 500 ng
EUR 603

VSIG4 Protein Vector (Mouse) (pPM-C-HA)

PV246684 500 ng
EUR 603

VSIG4 Protein Vector (Mouse) (pPM-C-His)

PV246685 500 ng
EUR 603

VSIG4 Protein Vector (Rat) (pPB-C-His)

PV316114 500 ng
EUR 603

VSIG4 Protein Vector (Rat) (pPB-N-His)

PV316115 500 ng
EUR 603

VSIG4 Protein Vector (Rat) (pPM-C-HA)

PV316116 500 ng
EUR 603

VSIG4 Protein Vector (Rat) (pPM-C-His)

PV316117 500 ng
EUR 603

VSIG4 Protein Vector (Human) (pPB-C-His)

PV045933 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPB-N-His)

PV045934 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPM-C-HA)

PV045935 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPM-C-His)

PV045936 500 ng
EUR 329

Vsig4 3'UTR Luciferase Stable Cell Line

TU122154 1.0 ml Ask for price

VSIG4 3'UTR GFP Stable Cell Line

TU078314 1.0 ml
EUR 1394

Vsig4 3'UTR GFP Stable Cell Line

TU172154 1.0 ml Ask for price

Vsig4 3'UTR Luciferase Stable Cell Line

TU223275 1.0 ml Ask for price

VSIG4 3'UTR Luciferase Stable Cell Line

TU028314 1.0 ml
EUR 1394

Vsig4 3'UTR GFP Stable Cell Line

TU273275 1.0 ml Ask for price

V-Set And Immunoglobulin Domain-Containing Protein 4 (VSIG4) Antibody

abx036350-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

V-Set And Immunoglobulin Domain-Containing Protein 4 (VSIG4) Antibody

abx030625-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

V-Set And Immunoglobulin Domain-Containing Protein 4 (VSIG4) Antibody

abx030625-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

V-Set And Immunoglobulin Domain-Containing Protein 4 (VSIG4) Antibody

20-abx302332
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VSIG4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650053 1.0 ug DNA
EUR 514

VSIG4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650057 1.0 ug DNA
EUR 514

VSIG4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650058 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VSIG4 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages