Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


BAMBI Rabbit Polyclonal Antibody

BAMBI Rabbit Polyclonal Antibody

Contact us: [email protected]

BAMBI Polyclonal Antibody

ABP57886-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BAMBI protein
  • Applications tips:
Description: A polyclonal antibody for detection of BAMBI from Human, Mouse, Rat. This BAMBI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAMBI protein

BAMBI Polyclonal Antibody

ES10956-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BAMBI from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BAMBI Polyclonal Antibody

ES10956-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BAMBI from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BAMBI Rabbit pAb

A13589-100ul 100 ul
EUR 308

BAMBI Rabbit pAb

A13589-200ul 200 ul
EUR 459

BAMBI Rabbit pAb

A13589-20ul 20 ul
EUR 183

BAMBI Rabbit pAb

A13589-50ul 50 ul
EUR 223

BAMBI Rabbit pAb

A6532-100ul 100 ul
EUR 308

BAMBI Rabbit pAb

A6532-200ul 200 ul
EUR 459

BAMBI Rabbit pAb

A6532-20ul 20 ul
EUR 183

BAMBI Rabbit pAb

A6532-50ul 50 ul
EUR 223

Polyclonal BAMBI Antibody (Internal)

APR15106G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAMBI (Internal). This antibody is tested and proven to work in the following applications:

BAMBI antibody

70R-15960 50 ul
EUR 435
Description: Rabbit polyclonal BAMBI antibody

BAMBI antibody

38985-100ul 100ul
EUR 252

BAMBI Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BAMBI. Recognizes BAMBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BAMBI Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against BAMBI. Recognizes BAMBI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BAMBI Antibody

DF12355 200ul
EUR 304
Description: BAMBI antibody detects endogenous levels of BAMBI.

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

EUR 517
  • Should the Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) in samples from tissue homogenates, cell lysates or other biological fluids.

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

EUR 673
  • Should the Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) in samples from tissue homogenates, cell lysates or other biological fluids.

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

RDR-BAMBI-Hu-48Tests 48 Tests
EUR 544

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

RDR-BAMBI-Hu-96Tests 96 Tests
EUR 756

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

RD-BAMBI-Hu-48Tests 48 Tests
EUR 521

Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit

RD-BAMBI-Hu-96Tests 96 Tests
EUR 723

BAMBI Conjugated Antibody

C38985 100ul
EUR 397

anti- BAMBI antibody

FNab00797 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: BMP and activin membrane-bound inhibitor homolog(Xenopus laevis)
  • Uniprot ID: Q13145
  • Gene ID: 25805
  • Research Area: Cancer
Description: Antibody raised against BAMBI

Anti-BAMBI antibody

PAab00797 100 ug
EUR 355

Anti-BAMBI antibody

STJ28615 100 µl
EUR 277
Description: This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis.

Anti-BAMBI antibody

STJ115550 100 µl
EUR 277
Description: This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis.

Anti-BAMBI antibody

STJ192114 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BAMBI

Bambi/ Rat Bambi ELISA Kit

ELI-49627r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-BAMBI/NMA Antibody

A07983-1 100ug/vial
EUR 294

BAMBI Blocking Peptide

DF12355-BP 1mg
EUR 195

BAMBI Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BAMBI cloning plasmid

CSB-CL615666HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 783
  • Sequence: atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctca
  • Show more
Description: A cloning plasmid for the BAMBI gene.


ELI-10944h 96 Tests
EUR 824

Mouse Bambi ELISA KIT

ELI-24471m 96 Tests
EUR 865


EF008059 96 Tests
EUR 689

Mouse BAMBI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat BAMBI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BAMBI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BAMBI Recombinant Protein (Human)

RP002611 100 ug Ask for price

BAMBI Recombinant Protein (Mouse)

RP118706 100 ug Ask for price

BAMBI Recombinant Protein (Rat)

RP191858 100 ug Ask for price

Anti-BAMBI (3C1-1D1)

YF-MA20180 100 ug
EUR 363
Description: Mouse monoclonal to BAMBI

BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BAMBI (Arg29~Asp130)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI)

Bambi ORF Vector (Rat) (pORF)

ORF063954 1.0 ug DNA
EUR 506

BAMBI Rabbit Polyclonal Antibody

Recent Posts


January 2022
