Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


RTN4R Rabbit Polyclonal Antibody

RTN4R Rabbit Polyclonal Antibody

Contact us: [email protected]

RTN4R Polyclonal Antibody

ES11347-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTN4R Rabbit pAb

A5847-100ul 100 ul
EUR 308

RTN4R Rabbit pAb

A5847-200ul 200 ul
EUR 459

RTN4R Rabbit pAb

A5847-20ul 20 ul
EUR 183

RTN4R Rabbit pAb

A5847-50ul 50 ul
EUR 223

RTN4R antibody

70R-20040 50 ul
EUR 435
Description: Rabbit polyclonal RTN4R antibody

RTN4R Antibody

33085-100ul 100ul
EUR 252

RTN4R Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human. This antibody is Unconjugated. Tested in the following application: ELISA

RTN4R Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

RTN4R antibody

70R-51087 100 ul
EUR 244
Description: Purified Polyclonal RTN4R antibody

RTN4R Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Rtn4r/ Rat Rtn4r ELISA Kit

ELI-40942r 96 Tests
EUR 886

RTN4R Conjugated Antibody

C33085 100ul
EUR 397

Anti-RTN4R antibody

STJ28410 100 µl
EUR 277
Description: This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.

Anti-RTN4R antibody

STJ192505 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RTN4R


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT12203 2 ug
EUR 391

RTN4R Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RTN4R cloning plasmid

CSB-CL880152HU-10ug 10ug
EUR 507
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1422
  • Sequence: atgaagagggcgtccgctggagggagccggctgctggcatgggtgctgtggctgcaggcctggcaggtggcagccccatgcccaggtgcctgcgtatgctacaatgagcccaaggtgacgacaagctgcccccagcagggcctgcaggctgtgcccgtgggcatccctgctgcca
  • Show more
Description: A cloning plasmid for the RTN4R gene.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse RTN4R shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RTN4R shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RTN4R shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT12765 2 ug
EUR 703

RTN4R Recombinant Protein (Human)

RP027400 100 ug Ask for price

RTN4R Recombinant Protein (Rat)

RP227240 100 ug Ask for price

RTN4R Recombinant Protein (Mouse)

RP169604 100 ug Ask for price

Mouse RTN4R PicoKine ELISA Kit

EK2066 96 wells
EUR 425
Description: For quantitative detection of mouse RTN4R in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rtn4r ORF Vector (Rat) (pORF)

ORF075748 1.0 ug DNA
EUR 506

RTN4R ORF Vector (Human) (pORF)

ORF009134 1.0 ug DNA
EUR 95

Rtn4r ORF Vector (Mouse) (pORF)

ORF056536 1.0 ug DNA
EUR 506

RTN4R ELISA Kit (Human) (OKCD01887)

OKCD01887 96 Wells
EUR 831
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL

Rtn4r ELISA Kit (Mouse) (OKBB01433)

OKBB01433 96 Wells
EUR 505
Description: Description of target: Reticulon 4 receptor (RTN4R) also known as Nogo-66 Receptor (NgR) or Nogo receptor 1 is a protein which in humans is encoded by the RTN4R gene. It is mapped to 16; 16 A3. This gene encodes the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

RTN4R ELISA Kit (Human) (OKCA02140)

OKCA02140 96 Wells
EUR 833
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

Rtn4r sgRNA CRISPR Lentivector set (Rat)

K7066201 3 x 1.0 ug
EUR 339

Rtn4r sgRNA CRISPR Lentivector set (Mouse)

K4654301 3 x 1.0 ug
EUR 339

RTN4R sgRNA CRISPR Lentivector set (Human)

K2076801 3 x 1.0 ug
EUR 339

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT

ELI-18409m 96 Tests
EUR 865

Human Reticulon- 4 receptor, RTN4R ELISA KIT

ELI-29471h 96 Tests
EUR 824

Human Reticulon 4 Receptor (RTN4R) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 1)

K7066202 1.0 ug DNA
EUR 154

Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 2)

K7066203 1.0 ug DNA
EUR 154

Rtn4r sgRNA CRISPR Lentivector (Rat) (Target 3)

K7066204 1.0 ug DNA
EUR 154

Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4654302 1.0 ug DNA
EUR 154

Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4654303 1.0 ug DNA
EUR 154

Rtn4r sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4654304 1.0 ug DNA
EUR 154

RTN4R sgRNA CRISPR Lentivector (Human) (Target 1)

K2076802 1.0 ug DNA
EUR 154

RTN4R sgRNA CRISPR Lentivector (Human) (Target 2)

K2076803 1.0 ug DNA
EUR 154

RTN4R sgRNA CRISPR Lentivector (Human) (Target 3)

K2076804 1.0 ug DNA
EUR 154

RTN4R Reticulon 4 Receptor Human Recombinant Protein

PROTQ9BZR6 Regular: 10ug
EUR 317
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

RTN4R Protein Vector (Rat) (pPB-C-His)

PV302990 500 ng
EUR 603

RTN4R Protein Vector (Rat) (pPB-N-His)

PV302991 500 ng
EUR 603

RTN4R Protein Vector (Rat) (pPM-C-HA)

PV302992 500 ng
EUR 603

RTN4R Protein Vector (Rat) (pPM-C-His)

PV302993 500 ng
EUR 603

RTN4R Protein Vector (Mouse) (pPB-C-His)

PV226142 500 ng
EUR 603

RTN4R Protein Vector (Mouse) (pPB-N-His)

PV226143 500 ng
EUR 603

RTN4R Protein Vector (Mouse) (pPM-C-HA)

PV226144 500 ng
EUR 603

RTN4R Protein Vector (Mouse) (pPM-C-His)

PV226145 500 ng
EUR 603

Human Reticulon 4 Receptor(RTN4R)ELISA Kit

QY-E01103 96T
EUR 361

RTN4R Protein Vector (Human) (pPB-C-His)

PV036533 500 ng
EUR 329

RTN4R Protein Vector (Human) (pPB-N-His)

PV036534 500 ng
EUR 329

RTN4R Protein Vector (Human) (pPM-C-HA)

PV036535 500 ng
EUR 329

RTN4R Protein Vector (Human) (pPM-C-His)

PV036536 500 ng
EUR 329

Recombinant Human RTN4R Protein, His, Insect-10ug

QP13370-10ug 10ug
EUR 201

Recombinant Human RTN4R Protein, His, Insect-1mg

QP13370-1mg 1mg
EUR 5251

Recombinant Human RTN4R Protein, His, Insect-2ug

QP13370-2ug 2ug
EUR 155

Rtn4r 3'UTR Luciferase Stable Cell Line

TU118245 1.0 ml Ask for price

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
  • Nogo-66 Receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rtn4r 3'UTR GFP Stable Cell Line

TU168245 1.0 ml Ask for price

Rtn4r 3'UTR Luciferase Stable Cell Line

TU219831 1.0 ml Ask for price

Rtn4r 3'UTR GFP Stable Cell Line

TU269831 1.0 ml Ask for price

RTN4R 3'UTR GFP Stable Cell Line

TU072463 1.0 ml
EUR 1394

RTN4R 3'UTR Luciferase Stable Cell Line

TU022463 1.0 ml
EUR 1394

ELISA kit for Human RTN4R (Reticulon 4 Receptor)

ELK5164 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RTN4R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV693739 1.0 ug DNA
EUR 682

RTN4R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV693743 1.0 ug DNA
EUR 682

RTN4R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV693744 1.0 ug DNA
EUR 682

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-48T 48T
EUR 332
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-96T 96T
EUR 539
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

RTN4R Rabbit Polyclonal Antibody

Recent Posts


January 2022
