Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


KLK5 Rabbit Polyclonal Antibody

KLK5 Rabbit Polyclonal Antibody

Contact us: [email protected]

KLK5 Polyclonal Antibody

ABP59064-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein

KLK5 Polyclonal Antibody

ABP59064-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KLK5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KLK5 from Human. This KLK5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK5 protein

KLK5 Polyclonal Antibody

ES11097-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK5 Polyclonal Antibody

ES11097-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-48T 48T
EUR 479
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Hu-96T 96T
EUR 621
  • Should the Human Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 5 (KLK5) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-48T 48T
EUR 489
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Kallikrein 5 (KLK5) ELISA Kit

DLR-KLK5-Mu-96T 96T
EUR 635
  • Should the Mouse Kallikrein 5 (KLK5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 5 (KLK5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Hu-48Tests 48 Tests
EUR 500

Human Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Hu-96Tests 96 Tests
EUR 692

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-48Tests 48 Tests
EUR 511

Mouse Kallikrein 5 (KLK5) ELISA Kit

RDR-KLK5-Mu-96Tests 96 Tests
EUR 709

Human Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Hu-48Tests 48 Tests
EUR 478

Human Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Hu-96Tests 96 Tests
EUR 662

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-48Tests 48 Tests
EUR 489

Mouse Kallikrein 5 (KLK5) ELISA Kit

RD-KLK5-Mu-96Tests 96 Tests
EUR 677

KLK5 Rabbit pAb

A10917-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A10917-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A10917-20ul 20 ul Ask for price

KLK5 Rabbit pAb

A10917-50ul 50 ul Ask for price

KLK5 Rabbit pAb

A2991-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A2991-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A2991-20ul 20 ul
EUR 183

KLK5 Rabbit pAb

A2991-50ul 50 ul
EUR 223

KLK5 Rabbit pAb

A14863-100ul 100 ul
EUR 308

KLK5 Rabbit pAb

A14863-200ul 200 ul
EUR 459

KLK5 Rabbit pAb

A14863-20ul 20 ul
EUR 183

KLK5 Rabbit pAb

A14863-50ul 50 ul
EUR 223

KLK5 antibody

70R-18162 50 ul
EUR 435
Description: Rabbit polyclonal KLK5 antibody

KLK5 antibody

70R-14167 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal KLK5 antibody

KLK5 Antibody

36941-100ul 100ul
EUR 252

KLK5 antibody

38528-100ul 100ul
EUR 252

KLK5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

KLK5 Antibody

DF7137 200ul
EUR 304
Description: KLK5 Antibody detects endogenous levels of total KLK5.

KLK5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

KLK5 antibody

70R-6355 50 ug
EUR 467
Description: Rabbit polyclonal KLK5 antibody raised against the N terminal of KLK5

KLK5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

KLK5 Antibody

ABD7137 100 ug
EUR 438

Polyclonal Goat Anti-KLK5 Antibody

APG00182G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KLK5 . This antibody is tested and proven to work in the following applications:

Kallikrein 5 (KLK5) polyclonal antibody

ABP-PAB-10238 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

KLK5 Polyclonal Antibody, HRP Conjugated

A51430 100 µg
EUR 570.55
Description: reagents widely cited

KLK5 Polyclonal Antibody, FITC Conjugated

A51431 100 µg
EUR 570.55
Description: Ask the seller for details

KLK5 Polyclonal Antibody, Biotin Conjugated

A51432 100 µg
EUR 570.55
Description: The best epigenetics products

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5)

KLK5 Conjugated Antibody

C36941 100ul
EUR 397

KLK5 Conjugated Antibody

C38528 100ul
EUR 397

Anti-KLK5 antibody

STJ24335 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ112813 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ117063 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-KLK5 antibody

STJ71121 100 µg
EUR 359

Anti-KLK5 antibody

STJ192255 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK5

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Biotin.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with Cy3.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with FITC.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with HRP.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with PE.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KLK5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KLK5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK5. Recognizes KLK5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Kallikrein 5 (KLK5) Antibody

  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx145910-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 5 (KLK5) Antibody

abx032799-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx032799-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

abx234459-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Kallikrein 5 (KLK5) Antibody

abx432899-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK5 (Ile25~Ala261)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Kallikrein 5 (KLK5). This antibody is labeled with APC-Cy7.

KLK5 Blocking Peptide

33R-1662 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK5 antibody, catalog no. 70R-6355

KLK5 cloning plasmid

CSB-CL897100HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 882
  • Sequence: atggctacagcaagacccccctggatgtgggtgctctgtgctctgatcacagccttgcttctgggggtcacagagcatgttctcgccaacaatgatgtttcctgtgaccacccctctaacaccgtgccctctgggagcaaccaggacctgggagctggggccggggaagacgcccg
  • Show more
Description: A cloning plasmid for the KLK5 gene.

KLK5 Blocking Peptide

DF7137-BP 1mg
EUR 195

Kallikrein 5 (KLK5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 5 (KLK5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Kallikrein 5/KLK5 Antibody

PA1630 100ug/vial
EUR 334

Human KLK5 ELISA Kit

55R-1762 1 kit
EUR 651
Description: ELISA Kit for detection of KLK5 in the research laboratory

KLK5 protein (His tag)

80R-2369 20 ug
EUR 349
Description: Purified recombinant Human KLK5 protein (His tag)

Human KLK5 ELISA Kit

ELA-E1163h 96 Tests
EUR 824


EF010935 96 Tests
EUR 689

Human KLK5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KLK5 ELISA Kit

LF-EK50922 1×96T
EUR 648

Kallikrein 5/KLK5/KLKL2

MO15028 500 ug
EUR 513

Kallikrein 5/KLK5/KLKL2

RA19046 100 ug
EUR 344

Recombinant Kallikrein 5 (KLK5)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15945
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Kallikrein 5 expressed in: E.coli

KLK5 Recombinant Protein (Human)

RP017254 100 ug Ask for price

KLK5 Recombinant Protein (Mouse)

RP146141 100 ug Ask for price

Mouse Kallikrein 5 (KLK5) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human KLK5 PicoKine ELISA Kit

EK0817 96 wells
EUR 456
Description: For quantitative detection of human KLK5 in cell culture supernates, serum, plasma(heparin , EDTA), human milk and saliva.

Human Kallikrein 5 (KLK5) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

KLK5 ORF Vector (Human) (pORF)

ORF005752 1.0 ug DNA
EUR 95

KLK5 Rabbit Polyclonal Antibody

Recent Posts


January 2022
