Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG


PARP6 Rabbit Polyclonal Antibody

PARP6 Rabbit Polyclonal Antibody

Contact us: [email protected]

PARP6 Polyclonal Antibody

ES10960-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PARP6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PARP6 antibody

70R-19120 50 ul
EUR 435
Description: Rabbit polyclonal PARP6 antibody

PARP6 antibody

70R-1039 100 ug
EUR 377
Description: Rabbit polyclonal PARP6 antibody

PARP6 antibody

70R-2153 50 ug
EUR 467
Description: Rabbit polyclonal PARP6 antibody

PARP6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PARP6. Recognizes PARP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PARP6 antibody

70R-8007 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PARP6 antibody

anti- PARP6 antibody

FNab06159 100µg
EUR 505.25
  • Immunogen: poly(ADP-ribose) polymerase family, member 6
  • Uniprot ID: Q2NL67
  • Gene ID: 56965
  • Research Area: Metabolism
Description: Antibody raised against PARP6

Anti-PARP6 antibody

PAab06159 100 ug
EUR 355

Anti-PARP6 antibody

STJ192118 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PARP6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PARP6 Blocking Peptide

33R-3755 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-1039

PARP6 Blocking Peptide

33R-4528 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-2153

PARP6 Blocking Peptide

33R-5840 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PARP6 antibody, catalog no. 70R-8007

PARP6 cloning plasmid

CSB-CL647549HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 330
  • Sequence: atgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatgaataccatcccccagacccgatccattcagtcacggttcctgcagagtcggaatctaaactgtatagcactttgtgaagtgattacatctaaggacctccagaagcatgggaa
  • Show more
Description: A cloning plasmid for the PARP6 gene.

PARP6 cloning plasmid

CSB-CL647549HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atgtttacatcccaacaatggaaacatctgagcaatgatttcttgaagacccagcaggagaagaggcacagttggttcaaggcaagtggtaccatcaagaagttccgagctggcctcagcatcttttcacccatccccaagtctcccagtttccctatcatacaggactccatgc
  • Show more
Description: A cloning plasmid for the PARP6 gene.


EF001568 96 Tests
EUR 689

Mouse PARP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PARP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PARP6 Recombinant Protein (Human)

RP022594 100 ug Ask for price

PARP6 Recombinant Protein (Human)

RP022597 100 ug Ask for price

PARP6 Recombinant Protein (Mouse)

RP160199 100 ug Ask for price

PARP6 Recombinant Protein (Mouse)

RP160202 100 ug Ask for price

PARP6 Recombinant Protein (Rat)

RP219347 100 ug Ask for price

Poly ADP Ribose Polymerase 6 (PARP6) Antibody

abx031373-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Poly ADP Ribose Polymerase 6 (PARP6) Antibody

abx031373-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Poly ADP Ribose Polymerase 6 (Parp6) Antibody

abx032783-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Poly ADP Ribose Polymerase 6 (Parp6) Antibody

abx032783-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Poly ADP Ribose Polymerase 6 (PARP6) Antibody

abx236159-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Parp6 ORF Vector (Rat) (pORF)

ORF073117 1.0 ug DNA
EUR 506

PARP6 ORF Vector (Human) (pORF)

ORF007532 1.0 ug DNA
EUR 95

PARP6 ORF Vector (Human) (pORF)

ORF007533 1.0 ug DNA
EUR 95

Parp6 ORF Vector (Mouse) (pORF)

ORF053401 1.0 ug DNA
EUR 506

Parp6 ORF Vector (Mouse) (pORF)

ORF053402 1.0 ug DNA
EUR 506

Parp6 sgRNA CRISPR Lentivector set (Rat)

K6583201 3 x 1.0 ug
EUR 339

Parp6 sgRNA CRISPR Lentivector set (Mouse)

K4575201 3 x 1.0 ug
EUR 339

PARP6 sgRNA CRISPR Lentivector set (Human)

K1596001 3 x 1.0 ug
EUR 339

Parp6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6583202 1.0 ug DNA
EUR 154

Parp6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6583203 1.0 ug DNA
EUR 154

Parp6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6583204 1.0 ug DNA
EUR 154

Parp6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4575202 1.0 ug DNA
EUR 154

Parp6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4575203 1.0 ug DNA
EUR 154

Parp6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4575204 1.0 ug DNA
EUR 154

PARP6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1596002 1.0 ug DNA
EUR 154

PARP6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1596003 1.0 ug DNA
EUR 154

PARP6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1596004 1.0 ug DNA
EUR 154

PARP6 3'UTR Luciferase Stable Cell Line

TU017413 1.0 ml
EUR 1394

Parp6 3'UTR Luciferase Stable Cell Line

TU115924 1.0 ml Ask for price

Parp6 3'UTR GFP Stable Cell Line

TU165924 1.0 ml Ask for price

Parp6 3'UTR Luciferase Stable Cell Line

TU215827 1.0 ml Ask for price

Parp6 3'UTR GFP Stable Cell Line

TU265827 1.0 ml Ask for price

PARP6 3'UTR GFP Stable Cell Line

TU067413 1.0 ml
EUR 1394

PARP6 Protein Vector (Rat) (pPB-C-His)

PV292466 500 ng
EUR 603

PARP6 Rabbit Polyclonal Antibody

Recent Posts


January 2022
