CLN8 Rabbit Polyclonal Antibody

Contact us: [email protected]

CLN8 Polyclonal Antibody
29954-50ul	SAB	50ul	EUR 187

CLN8 Polyclonal Antibody
ABP58192-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280 Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280

CLN8 Polyclonal Antibody
ABP58192-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280 Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280

CLN8 Polyclonal Antibody
ABP58192-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280 Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280

CLN8 Polyclonal Antibody
ES11417-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CLN8 Polyclonal Antibody
ES11417-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Protein CLN8 (CLN8) Antibody
abx030518-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein CLN8 (CLN8) Antibody
abx030518-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

CLN8 Rabbit pAb
A16843-100ul	Abclonal	100 ul	EUR 308

CLN8 Rabbit pAb
A16843-200ul	Abclonal	200 ul	EUR 459

CLN8 Rabbit pAb
A16843-20ul	Abclonal	20 ul	EUR 183

CLN8 Rabbit pAb
A16843-50ul	Abclonal	50 ul	EUR 223

CLN8 Polyclonal Conjugated Antibody
C29954	SAB	100ul	EUR 397

CLN8 Antibody
1-CSB-PA866210LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CLN8 antibody
70R-7114	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CLN8 antibody

CLN8 antibody
70R-7115	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CLN8 antibody

Polyclonal CLN8 Antibody (C-term)
APG02662G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN8 (C-term). This antibody is tested and proven to work in the following applications:

Cln8/ Rat Cln8 ELISA Kit
ELI-10196r	Lifescience Market	96 Tests	EUR 886

Anti-CLN8 antibody
STJ119214	St John's Laboratory	100 µl	EUR 277

Anti-CLN8 antibody
STJ192575	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CLN8

Human Protein CLN8, CLN8 ELISA KIT
ELI-31913h	Lifescience Market	96 Tests	EUR 824

Mouse Protein CLN8, Cln8 ELISA KIT
ELI-50182m	Lifescience Market	96 Tests	EUR 865

CLN8 siRNA
20-abx901117	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLN8 siRNA
20-abx912107	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLN8 siRNA
20-abx912108	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLN8 Antibody, HRP conjugated
1-CSB-PA866210LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CLN8 Antibody, FITC conjugated
1-CSB-PA866210LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CLN8 Antibody, Biotin conjugated
1-CSB-PA866210LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CLN8 Blocking Peptide
33R-9526	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7115

CLN8 Blocking Peptide
33R-6257	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7114

CLN8 cloning plasmid
CSB-CL866210HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 861 Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccag Show more
Description: A cloning plasmid for the CLN8 gene.

Canine CLN8 ELISA KIT
ELI-25817d	Lifescience Market	96 Tests	EUR 928

Rat CLN8 shRNA Plasmid
20-abx989401	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CLN8 shRNA Plasmid
20-abx973766	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CLN8 shRNA Plasmid
20-abx951432	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CLN8 Recombinant Protein (Human)
RP007384	ABM	100 ug	Ask for price

CLN8 Recombinant Protein (Rat)
RP195413	ABM	100 ug	Ask for price

CLN8 Recombinant Protein (Mouse)
RP124760	ABM	100 ug	Ask for price

Cln8 ORF Vector (Rat) (pORF)
ORF065139	ABM	1.0 ug DNA	EUR 506

CLN8 ORF Vector (Human) (pORF)
ORF002462	ABM	1.0 ug DNA	EUR 95

Cln8 ORF Vector (Mouse) (pORF)
ORF041588	ABM	1.0 ug DNA	EUR 506

CLN8 sgRNA CRISPR Lentivector set (Human)
K0467001	ABM	3 x 1.0 ug	EUR 339

Cln8 sgRNA CRISPR Lentivector set (Rat)
K7233701	ABM	3 x 1.0 ug	EUR 339

Cln8 sgRNA CRISPR Lentivector set (Mouse)
K4701101	ABM	3 x 1.0 ug	EUR 339

CLN8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0467002	ABM	1.0 ug DNA	EUR 154

CLN8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0467003	ABM	1.0 ug DNA	EUR 154

CLN8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0467004	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7233702	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7233703	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7233704	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4701102	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4701103	ABM	1.0 ug DNA	EUR 154

Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4701104	ABM	1.0 ug DNA	EUR 154

CLN8 Protein Vector (Mouse) (pPB-C-His)
PV166350	ABM	500 ng	EUR 603

CLN8 Protein Vector (Mouse) (pPB-N-His)
PV166351	ABM	500 ng	EUR 603

CLN8 Protein Vector (Mouse) (pPM-C-HA)
PV166352	ABM	500 ng	EUR 603

CLN8 Protein Vector (Mouse) (pPM-C-His)
PV166353	ABM	500 ng	EUR 603

CLN8 Protein Vector (Rat) (pPB-C-His)
PV260554	ABM	500 ng	EUR 603

CLN8 Protein Vector (Rat) (pPB-N-His)
PV260555	ABM	500 ng	EUR 603

CLN8 Protein Vector (Rat) (pPM-C-HA)
PV260556	ABM	500 ng	EUR 603

CLN8 Protein Vector (Rat) (pPM-C-His)
PV260557	ABM	500 ng	EUR 603

CLN8 Protein Vector (Human) (pPB-C-His)
PV009845	ABM	500 ng	EUR 329

CLN8 Protein Vector (Human) (pPB-N-His)
PV009846	ABM	500 ng	EUR 329

CLN8 Protein Vector (Human) (pPM-C-HA)
PV009847	ABM	500 ng	EUR 329

CLN8 Protein Vector (Human) (pPM-C-His)
PV009848	ABM	500 ng	EUR 329

Cln8 3'UTR GFP Stable Cell Line
TU154036	ABM	1.0 ml	Ask for price

Cln8 3'UTR Luciferase Stable Cell Line
TU104036	ABM	1.0 ml	Ask for price

Cln8 3'UTR Luciferase Stable Cell Line
TU202485	ABM	1.0 ml	Ask for price

Cln8 3'UTR GFP Stable Cell Line
TU252485	ABM	1.0 ml	Ask for price

CLN8 3'UTR GFP Stable Cell Line
TU054601	ABM	1.0 ml	EUR 4617

CLN8 3'UTR Luciferase Stable Cell Line
TU004601	ABM	1.0 ml	EUR 4617

CLN8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV672871	ABM	1.0 ug DNA	EUR 514

CLN8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV672875	ABM	1.0 ug DNA	EUR 514

CLN8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV672876	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

CLN8 Rabbit Polyclonal Antibody