Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

CLN8 Rabbit Polyclonal Antibody

CLN8 Rabbit Polyclonal Antibody

Contact us: [email protected]

CLN8 Polyclonal Antibody
29954-50ul 50ul
EUR 187
CLN8 Polyclonal Antibody
ABP58192-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
CLN8 Polyclonal Antibody
ABP58192-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
CLN8 Polyclonal Antibody
ABP58192-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of CLN8 from Human. This CLN8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLN8 protein at amino acid sequence of 231-280
CLN8 Polyclonal Antibody
ES11417-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CLN8 Polyclonal Antibody
ES11417-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Protein CLN8 (CLN8) Antibody
abx030518-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protein CLN8 (CLN8) Antibody
abx030518-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
CLN8 Rabbit pAb
A16843-100ul 100 ul
EUR 308
CLN8 Rabbit pAb
A16843-200ul 200 ul
EUR 459
CLN8 Rabbit pAb
A16843-20ul 20 ul
EUR 183
CLN8 Rabbit pAb
A16843-50ul 50 ul
EUR 223
CLN8 Polyclonal Conjugated Antibody
C29954 100ul
EUR 397
CLN8 Antibody
1-CSB-PA866210LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
CLN8 antibody
70R-7114 50 ug
EUR 467
Description: Rabbit polyclonal CLN8 antibody
CLN8 antibody
70R-7115 50 ug
EUR 467
Description: Rabbit polyclonal CLN8 antibody
Polyclonal CLN8 Antibody (C-term)
APG02662G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN8 (C-term). This antibody is tested and proven to work in the following applications:
Cln8/ Rat Cln8 ELISA Kit
ELI-10196r 96 Tests
EUR 886
Anti-CLN8 antibody
STJ119214 100 µl
EUR 277
Anti-CLN8 antibody
STJ192575 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CLN8
Human Protein CLN8, CLN8 ELISA KIT
ELI-31913h 96 Tests
EUR 824
Mouse Protein CLN8, Cln8 ELISA KIT
ELI-50182m 96 Tests
EUR 865
CLN8 siRNA
20-abx901117
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CLN8 siRNA
20-abx912107
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CLN8 siRNA
20-abx912108
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CLN8 Antibody, HRP conjugated
1-CSB-PA866210LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CLN8 Antibody, FITC conjugated
1-CSB-PA866210LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CLN8 Antibody, Biotin conjugated
1-CSB-PA866210LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CLN8 Blocking Peptide
33R-9526 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7115
CLN8 Blocking Peptide
33R-6257 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7114
CLN8 cloning plasmid
CSB-CL866210HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 861
  • Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccag
  • Show more
Description: A cloning plasmid for the CLN8 gene.
Canine CLN8 ELISA KIT
ELI-25817d 96 Tests
EUR 928
Rat CLN8 shRNA Plasmid
20-abx989401
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CLN8 shRNA Plasmid
20-abx973766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CLN8 shRNA Plasmid
20-abx951432
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CLN8 Recombinant Protein (Human)
RP007384 100 ug Ask for price
CLN8 Recombinant Protein (Rat)
RP195413 100 ug Ask for price
CLN8 Recombinant Protein (Mouse)
RP124760 100 ug Ask for price
Cln8 ORF Vector (Rat) (pORF)
ORF065139 1.0 ug DNA
EUR 506
CLN8 ORF Vector (Human) (pORF)
ORF002462 1.0 ug DNA
EUR 95
Cln8 ORF Vector (Mouse) (pORF)
ORF041588 1.0 ug DNA
EUR 506
CLN8 sgRNA CRISPR Lentivector set (Human)
K0467001 3 x 1.0 ug
EUR 339
Cln8 sgRNA CRISPR Lentivector set (Rat)
K7233701 3 x 1.0 ug
EUR 339
Cln8 sgRNA CRISPR Lentivector set (Mouse)
K4701101 3 x 1.0 ug
EUR 339
CLN8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0467002 1.0 ug DNA
EUR 154
CLN8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0467003 1.0 ug DNA
EUR 154
CLN8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0467004 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7233702 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7233703 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7233704 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4701102 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4701103 1.0 ug DNA
EUR 154
Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4701104 1.0 ug DNA
EUR 154
CLN8 Protein Vector (Mouse) (pPB-C-His)
PV166350 500 ng
EUR 603
CLN8 Protein Vector (Mouse) (pPB-N-His)
PV166351 500 ng
EUR 603
CLN8 Protein Vector (Mouse) (pPM-C-HA)
PV166352 500 ng
EUR 603
CLN8 Protein Vector (Mouse) (pPM-C-His)
PV166353 500 ng
EUR 603
CLN8 Protein Vector (Rat) (pPB-C-His)
PV260554 500 ng
EUR 603
CLN8 Protein Vector (Rat) (pPB-N-His)
PV260555 500 ng
EUR 603
CLN8 Protein Vector (Rat) (pPM-C-HA)
PV260556 500 ng
EUR 603
CLN8 Protein Vector (Rat) (pPM-C-His)
PV260557 500 ng
EUR 603
CLN8 Protein Vector (Human) (pPB-C-His)
PV009845 500 ng
EUR 329
CLN8 Protein Vector (Human) (pPB-N-His)
PV009846 500 ng
EUR 329
CLN8 Protein Vector (Human) (pPM-C-HA)
PV009847 500 ng
EUR 329
CLN8 Protein Vector (Human) (pPM-C-His)
PV009848 500 ng
EUR 329
Cln8 3'UTR GFP Stable Cell Line
TU154036 1.0 ml Ask for price
Cln8 3'UTR Luciferase Stable Cell Line
TU104036 1.0 ml Ask for price
Cln8 3'UTR Luciferase Stable Cell Line
TU202485 1.0 ml Ask for price
Cln8 3'UTR GFP Stable Cell Line
TU252485 1.0 ml Ask for price
CLN8 3'UTR GFP Stable Cell Line
TU054601 1.0 ml
EUR 4617
CLN8 3'UTR Luciferase Stable Cell Line
TU004601 1.0 ml
EUR 4617
CLN8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV672871 1.0 ug DNA
EUR 514
CLN8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV672875 1.0 ug DNA
EUR 514
CLN8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV672876 1.0 ug DNA
EUR 514
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

CLN8 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages