RSPO3 Rabbit Polyclonal Antibody

Contact us: [email protected]

RSPO3 Polyclonal Antibody
31537-50ul	SAB	50ul	EUR 187

Polyclonal RSPO3 Antibody
APR06910G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 . This antibody is tested and proven to work in the following applications:

RSPO3 Polyclonal Antibody
A67930	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RSPO3 Polyclonal Antibody
A60722	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RSPO3 Polyclonal Antibody
ABP60272-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody
ABP60272-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody
ABP60272-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein

RSPO3 Polyclonal Antibody
ES11202-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RSPO3 Polyclonal Antibody
ES11202-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-48T	DL Develop	48T	EUR 554
Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-96T	DL Develop	96T	EUR 725
Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

RSPO3 Rabbit pAb
A8389-100ul	Abclonal	100 ul	EUR 308

RSPO3 Rabbit pAb
A8389-200ul	Abclonal	200 ul	EUR 459

RSPO3 Rabbit pAb
A8389-20ul	Abclonal	20 ul	EUR 183

RSPO3 Rabbit pAb
A8389-50ul	Abclonal	50 ul	EUR 223

RSPO3 Polyclonal Conjugated Antibody
C31537	SAB	100ul	EUR 397

RSPO3 Antibody
1-CSB-PA887154LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RSPO3 Antibody
DF12728	Affbiotech	200ul	EUR 304
Description: RSPO3 Antibody detects endogenous levels of RSPO3.

Polyclonal RSPO3 Antibody (C-Term)
APR04974G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RSPO3 Antibody (internal region)
APG00723G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RSPO3 (internal region). This antibody is tested and proven to work in the following applications:

RSPO3 Polyclonal Antibody, HRP Conjugated
A67931	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RSPO3 Polyclonal Antibody, FITC Conjugated
A67932	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RSPO3 Polyclonal Antibody, Biotin Conjugated
A67933	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RSPO3 Polyclonal Antibody, Biotin Conjugated
A60723	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RSPO3 Polyclonal Antibody, FITC Conjugated
A60724	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RSPO3 Polyclonal Antibody, HRP Conjugated
A60725	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

anti- RSPO3 antibody
FNab07512	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IHC: 1:100-1:400 Immunogen: R-spondin 3 homolog Uniprot ID: Q9BXY4 Gene ID: 84870 Research Area: Neuroscience
Description: Antibody raised against RSPO3

Anti-RSPO3 antibody
PAab07512	Lifescience Market	100 ug	EUR 386

Anti-RSPO3 antibody
STJ110687	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.

Anti-RSPO3 antibody
STJ192360	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RSPO3

RSPO3 siRNA
20-abx932215	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RSPO3 siRNA
20-abx932216	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RSPO3 Antibody, HRP conjugated
1-CSB-PA887154LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RSPO3 Antibody, FITC conjugated
1-CSB-PA887154LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RSPO3 Antibody, Biotin conjugated
1-CSB-PA887154LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig)
4-PAM173Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3)

RSPO3 Blocking Peptide
DF12728-BP	Affbiotech	1mg	EUR 195

RSPO3 cloning plasmid
CSB-CL887154HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 819 Sequence: atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcc Show more
Description: A cloning plasmid for the RSPO3 gene.

R-Spondin 3 (RSPO3) Antibody
20-abx007316	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody
20-abx129057	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

R-Spondin 3 (RSPO3) Antibody
20-abx174431	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

R-Spondin 3 (RSPO3) Antibody
abx237512-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

R-Spondin 3 (RSPO3) Antibody
abx432159-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

R-Spondin 3 (RSPO3) Antibody
20-abx311988	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC
4-PAM173Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAM173Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Biotin.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Cy3
4-PAM173Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Cy3.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), FITC
4-PAM173Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with FITC.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), HRP
4-PAM173Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with HRP.

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), PE
4-PAM173Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with PE.

R-Spondin 3 (RSPO3) Antibody (HRP)
20-abx311989	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody (FITC)
20-abx311990	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

R-Spondin 3 (RSPO3) Antibody (Biotin)
20-abx311991	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RSPO3 ELISA KIT|Human
EF002662	Lifescience Market	96 Tests	EUR 689

Mouse RSPO3 shRNA Plasmid
20-abx977856	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RSPO3 shRNA Plasmid
20-abx963652	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RSPO3 Recombinant Protein (Human)
RP027346	ABM	100 ug	Ask for price

RSPO3 Recombinant Protein (Rat)
RP227030	ABM	100 ug	Ask for price

RSPO3 Recombinant Protein (Mouse)
RP169490	ABM	100 ug	Ask for price

R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAM173Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RSPO3 (Gln22~His272) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC-Cy7.

Rspo3 ORF Vector (Rat) (pORF)
ORF075678	ABM	1.0 ug DNA	EUR 506

RSPO3 ORF Vector (Human) (pORF)
ORF009116	ABM	1.0 ug DNA	EUR 95

Rspo3 ORF Vector (Mouse) (pORF)
ORF056498	ABM	1.0 ug DNA	EUR 506

Recombinant R-Spondin 3 (RSPO3)
4-RPM173Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BXY4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.0kDa Isoelectric Point: Inquire
Description: Recombinant Human R-Spondin 3 expressed in: E.coli

RSPO3 ELISA Kit (Human) (OKCD01079)
OKCD01079	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

RSPO3 ELISA Kit (Human) (OKBB01047)
OKBB01047	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: R-spondin-3 is a protein that in humans is encoded by the RSPO3 gene. This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

RSPO3 ELISA Kit (Mouse) (OKBB01058)
OKBB01058	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: R-spondin-3 is a protein that in humans is encoded by the RSPO3 gene. This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

RSPO3 ELISA Kit (Mouse) (OKCA00922)
OKCA00922	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors, which acts as a key regulator of angiogenesis . Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Acts as a ligand for frizzled FZD8 and LRP6. May negatively regulate the TGF-beta pathway . Acts as a key regulator of angiogenesis by controlling vascular stability and pruning: acts by activating the non-canonical Wnt signaling pathway in endothelial cells .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.17 pg/mL

Human R-Spondin 3 (RSPO3) Protein
20-abx166703	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rspo3 sgRNA CRISPR Lentivector set (Rat)
K7578901	ABM	3 x 1.0 ug	EUR 339

Rspo3 sgRNA CRISPR Lentivector set (Mouse)
K4016201	ABM	3 x 1.0 ug	EUR 339

RSPO3 sgRNA CRISPR Lentivector set (Human)
K2074601	ABM	3 x 1.0 ug	EUR 339

Mouse R-spondin-3(RSPO3) ELISA kit
CSB-EL020552MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-3 (RSPO3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse R-spondin-3(RSPO3) ELISA kit
1-CSB-EL020552MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-3(RSPO3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human R-Spondin 3 (RSPO3) ELISA Kit
20-abx152988	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse R- spondin- 3, Rspo3 ELISA KIT
ELI-14334m	Lifescience Market	96 Tests	EUR 865

Bovine R- spondin- 3, RSPO3 ELISA KIT
ELI-52753b	Lifescience Market	96 Tests	EUR 928

Human R-Spondin 3 (RSPO3) CLIA Kit
20-abx496031	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human R- spondin- 3, RSPO3 ELISA KIT
ELI-36329h	Lifescience Market	96 Tests	EUR 824

Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7578902	ABM	1.0 ug DNA	EUR 154

Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7578903	ABM	1.0 ug DNA	EUR 154

Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7578904	ABM	1.0 ug DNA	EUR 154

Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4016202	ABM	1.0 ug DNA	EUR 154

Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4016203	ABM	1.0 ug DNA	EUR 154

Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4016204	ABM	1.0 ug DNA	EUR 154

RSPO3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2074602	ABM	1.0 ug DNA	EUR 154

RSPO3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2074603	ABM	1.0 ug DNA	EUR 154

RSPO3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2074604	ABM	1.0 ug DNA	EUR 154

RSPO3 R-Spondin-3 Human Recombinant Protein
PROTQ9BXY4	BosterBio	Regular: 20ug	EUR 317
Description: Recombinant Human R-Spondin-3 produced in HEK293 cells is a polypeptide chain starting at amino acid at position 22 to amino acid at position 200, fused to an FC-6xHis-tag at C-terminus, containing a total of 498 amino acids. ;RSPO3 is a truncated protein that lacks amino acid V at position 180 to amino acid H at position 251 and purified by proprietary chromatographic techniques.

RSPO3 Protein Vector (Rat) (pPB-C-His)
PV302710	ABM	500 ng	EUR 603

RSPO3 Protein Vector (Rat) (pPB-N-His)
PV302711	ABM	500 ng	EUR 603

RSPO3 Rabbit Polyclonal Antibody