Anti-Mouse Antibody Products

Mouse anti-rabbit IgG mAb was detected using Anti-mouse IgG

fallback-image

RSPO3 Rabbit Polyclonal Antibody

RSPO3 Rabbit Polyclonal Antibody

Contact us: [email protected]

RSPO3 Polyclonal Antibody
31537-50ul 50ul
EUR 187
Polyclonal RSPO3 Antibody
APR06910G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 . This antibody is tested and proven to work in the following applications:
RSPO3 Polyclonal Antibody
A67930 100 µg
EUR 570.55
Description: kits suitable for this type of research
RSPO3 Polyclonal Antibody
A60722 100 µg
EUR 570.55
Description: The best epigenetics products
RSPO3 Polyclonal Antibody
ABP60272-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
ABP60272-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
ABP60272-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RSPO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RSPO3 from Human, Mouse. This RSPO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RSPO3 protein
RSPO3 Polyclonal Antibody
ES11202-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RSPO3 Polyclonal Antibody
ES11202-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RSPO3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-48T 48T
EUR 554
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.
Human R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Hu-96T 96T
EUR 725
  • Should the Human R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human R-Spondin 3 (RSPO3) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-48T 48T
EUR 566
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse R-Spondin 3 (RSPO3) ELISA Kit
DLR-RSPO3-Mu-96T 96T
EUR 741
  • Should the Mouse R-Spondin 3 (RSPO3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse R-Spondin 3 (RSPO3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-48Tests 48 Tests
EUR 589
Human R-Spondin 3 (RSPO3) ELISA Kit
RDR-RSPO3-Hu-96Tests 96 Tests
EUR 820
Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-48Tests 48 Tests
EUR 563
Human R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Hu-96Tests 96 Tests
EUR 783
Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-48Tests 48 Tests
EUR 577
Mouse R-Spondin 3 (RSPO3) ELISA Kit
RD-RSPO3-Mu-96Tests 96 Tests
EUR 802
RSPO3 Rabbit pAb
A8389-100ul 100 ul
EUR 308
RSPO3 Rabbit pAb
A8389-200ul 200 ul
EUR 459
RSPO3 Rabbit pAb
A8389-20ul 20 ul
EUR 183
RSPO3 Rabbit pAb
A8389-50ul 50 ul
EUR 223
RSPO3 Polyclonal Conjugated Antibody
C31537 100ul
EUR 397
RSPO3 Antibody
1-CSB-PA887154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
RSPO3 Antibody
DF12728 200ul
EUR 304
Description: RSPO3 Antibody detects endogenous levels of RSPO3.
Polyclonal RSPO3 Antibody (C-Term)
APR04974G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RSPO3 (C-Term). This antibody is tested and proven to work in the following applications:
Polyclonal RSPO3 Antibody (internal region)
APG00723G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RSPO3 (internal region). This antibody is tested and proven to work in the following applications:
RSPO3 Polyclonal Antibody, HRP Conjugated
A67931 100 µg
EUR 570.55
Description: fast delivery possible
RSPO3 Polyclonal Antibody, FITC Conjugated
A67932 100 µg
EUR 570.55
Description: reagents widely cited
RSPO3 Polyclonal Antibody, Biotin Conjugated
A67933 100 µg
EUR 570.55
Description: Ask the seller for details
RSPO3 Polyclonal Antibody, Biotin Conjugated
A60723 100 µg
EUR 570.55
Description: kits suitable for this type of research
RSPO3 Polyclonal Antibody, FITC Conjugated
A60724 100 µg
EUR 570.55
Description: fast delivery possible
RSPO3 Polyclonal Antibody, HRP Conjugated
A60725 100 µg
EUR 570.55
Description: reagents widely cited
anti- RSPO3 antibody
FNab07512 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:400
  • Immunogen: R-spondin 3 homolog
  • Uniprot ID: Q9BXY4
  • Gene ID: 84870
  • Research Area: Neuroscience
Description: Antibody raised against RSPO3
Anti-RSPO3 antibody
PAab07512 100 ug
EUR 386
Anti-RSPO3 antibody
STJ110687 100 µl
EUR 277
Description: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.
Anti-RSPO3 antibody
STJ192360 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RSPO3
RSPO3 siRNA
20-abx932215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RSPO3 siRNA
20-abx932216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RSPO3 Antibody, HRP conjugated
1-CSB-PA887154LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RSPO3 Antibody, FITC conjugated
1-CSB-PA887154LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RSPO3 Antibody, Biotin conjugated
1-CSB-PA887154LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RSPO3. Recognizes RSPO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig)
4-PAM173Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3)
RSPO3 Blocking Peptide
DF12728-BP 1mg
EUR 195
RSPO3 cloning plasmid
CSB-CL887154HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcc
  • Show more
Description: A cloning plasmid for the RSPO3 gene.
R-Spondin 3 (RSPO3) Antibody
20-abx007316
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Antibody
20-abx129057
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
R-Spondin 3 (RSPO3) Antibody
20-abx174431
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
R-Spondin 3 (RSPO3) Antibody
abx237512-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
R-Spondin 3 (RSPO3) Antibody
abx432159-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
R-Spondin 3 (RSPO3) Antibody
20-abx311988
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC
4-PAM173Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAM173Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Biotin.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), Cy3
4-PAM173Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with Cy3.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), FITC
4-PAM173Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with FITC.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), HRP
4-PAM173Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with HRP.
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), PE
4-PAM173Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with PE.
R-Spondin 3 (RSPO3) Antibody (HRP)
20-abx311989
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Antibody (FITC)
20-abx311990
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
R-Spondin 3 (RSPO3) Antibody (Biotin)
20-abx311991
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RSPO3 ELISA KIT|Human
EF002662 96 Tests
EUR 689
Mouse RSPO3 shRNA Plasmid
20-abx977856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RSPO3 shRNA Plasmid
20-abx963652
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RSPO3 Recombinant Protein (Human)
RP027346 100 ug Ask for price
RSPO3 Recombinant Protein (Rat)
RP227030 100 ug Ask for price
RSPO3 Recombinant Protein (Mouse)
RP169490 100 ug Ask for price
R-Spondin 3 (RSPO3) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAM173Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RSPO3 (Gln22~His272)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig R-Spondin 3 (RSPO3). This antibody is labeled with APC-Cy7.
Rspo3 ORF Vector (Rat) (pORF)
ORF075678 1.0 ug DNA
EUR 506
RSPO3 ORF Vector (Human) (pORF)
ORF009116 1.0 ug DNA
EUR 95
Rspo3 ORF Vector (Mouse) (pORF)
ORF056498 1.0 ug DNA
EUR 506
Recombinant R-Spondin 3 (RSPO3)
4-RPM173Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BXY4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human R-Spondin 3 expressed in: E.coli
RSPO3 ELISA Kit (Human) (OKCD01079)
OKCD01079 96 Wells
EUR 909
Description: Description of target: This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL
RSPO3 ELISA Kit (Human) (OKBB01047)
OKBB01047 96 Wells
EUR 505
Description: Description of target: R-spondin-3 is a protein that in humans is encoded by the RSPO3 gene. This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
RSPO3 ELISA Kit (Mouse) (OKBB01058)
OKBB01058 96 Wells
EUR 505
Description: Description of target: R-spondin-3 is a protein that in humans is encoded by the RSPO3 gene. This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
RSPO3 ELISA Kit (Mouse) (OKCA00922)
OKCA00922 96 Wells
EUR 833
Description: Description of target: Activator of the canonical Wnt signaling pathway by acting as a ligand for LGR4-6 receptors, which acts as a key regulator of angiogenesis . Upon binding to LGR4-6 (LGR4, LGR5 or LGR6), LGR4-6 associate with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. Also regulates the canonical Wnt/beta-catenin-dependent pathway and non-canonical Wnt signaling by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. Acts as a ligand for frizzled FZD8 and LRP6. May negatively regulate the TGF-beta pathway . Acts as a key regulator of angiogenesis by controlling vascular stability and pruning: acts by activating the non-canonical Wnt signaling pathway in endothelial cells .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.17 pg/mL
Human R-Spondin 3 (RSPO3) Protein
20-abx166703
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rspo3 sgRNA CRISPR Lentivector set (Rat)
K7578901 3 x 1.0 ug
EUR 339
Rspo3 sgRNA CRISPR Lentivector set (Mouse)
K4016201 3 x 1.0 ug
EUR 339
RSPO3 sgRNA CRISPR Lentivector set (Human)
K2074601 3 x 1.0 ug
EUR 339
Mouse R-spondin-3(RSPO3) ELISA kit
CSB-EL020552MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-3 (RSPO3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse R-spondin-3(RSPO3) ELISA kit
1-CSB-EL020552MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse R-spondin-3(RSPO3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human R-Spondin 3 (RSPO3) ELISA Kit
20-abx152988
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse R- spondin- 3, Rspo3 ELISA KIT
ELI-14334m 96 Tests
EUR 865
Bovine R- spondin- 3, RSPO3 ELISA KIT
ELI-52753b 96 Tests
EUR 928
Human R-Spondin 3 (RSPO3) CLIA Kit
20-abx496031
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human R- spondin- 3, RSPO3 ELISA KIT
ELI-36329h 96 Tests
EUR 824
Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7578902 1.0 ug DNA
EUR 154
Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7578903 1.0 ug DNA
EUR 154
Rspo3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7578904 1.0 ug DNA
EUR 154
Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4016202 1.0 ug DNA
EUR 154
Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4016203 1.0 ug DNA
EUR 154
Rspo3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4016204 1.0 ug DNA
EUR 154
RSPO3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2074602 1.0 ug DNA
EUR 154
RSPO3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2074603 1.0 ug DNA
EUR 154
RSPO3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2074604 1.0 ug DNA
EUR 154
RSPO3 R-Spondin-3 Human Recombinant Protein
PROTQ9BXY4 Regular: 20ug
EUR 317
Description: Recombinant Human R-Spondin-3 produced in HEK293 cells is a polypeptide chain starting at amino acid at position 22 to amino acid at position 200, fused to an FC-6xHis-tag at C-terminus, containing a total of 498 amino acids. ;RSPO3 is a truncated protein that lacks amino acid V at position 180 to amino acid H at position 251 and purified by proprietary chromatographic techniques.
RSPO3 Protein Vector (Rat) (pPB-C-His)
PV302710 500 ng
EUR 603
RSPO3 Protein Vector (Rat) (pPB-N-His)
PV302711 500 ng
EUR 603

RSPO3 Rabbit Polyclonal Antibody

Recent Posts

Categories

January 2022
M T W T F S S
 12
3456789
10111213141516
17181920212223
24252627282930
31  

Pages